General Information of the Ferroptosis Regulator (ID: REG20029)
Regulator Name hsa-miR-150-5p (miRNA)
Synonyms
hsa-miR-150-5p
    Click to Show/Hide
Gene Name hsa-miR-150-5p
Regulator Type miRNA
MiRBase ID MIMAT0000451
Sequence
UCUCCCAACCCUUGUACCAGUG

    Click to Show/Hide
Full List of the Ferroptosis Target of This Regulator and Corresponding Disease/Drug Response(s)
hsa-miR-150-5p can regulate the following target(s), and cause disease/drug response(s). You can browse detail information of target(s) or disease/drug response(s).
Browse Target
Browse Disease
Browse Drug
Long-chain-fatty-acid--CoA ligase 4 (ACSL4) [Driver]
In total 1 item(s) under this target
Experiment 1 Reporting the Ferroptosis Target of This Regulator [1]
Target for Ferroptosis Driver
Responsed Disease Colorectal cancer ICD-11: 2B91
Responsed Drug Bromelain Investigative
Pathway Response Fatty acid metabolism hsa01212
Ferroptosis hsa04216
Cell Process Cell ferroptosis
Cell proliferation
In Vitro Model
NCI-H508 cells Cecum adenocarcinoma Homo sapiens CVCL_1564
HCT 116 cells Colon carcinoma Homo sapiens CVCL_0291
G13D (Human colorectal cancer cells)
DLD-1 cells Colon adenocarcinoma Homo sapiens CVCL_0248
G12D (Human colorectal cancer cells)
CCD-18Co cells Normal Homo sapiens CVCL_2379
In Vivo Model
Animals (n = 7) were given 2.5% DSS in drinking water for 5 days and then no treatment for 14 days as one cycle; this process was repeated for three cycles. In the last cycle, 2% DSS water treated to each group and no treatment for 14 days. During the three DSS cycle, 3 mg/kg bromelain were injected daily intraperitoneally and colon and spleen tissues were harvested after three DSS cycle in 57 days to study polyp burden and to perform histological staining.

    Click to Show/Hide
Response regulation Elevated miR-19b-3p, -130a-3p, -150-5p, -144-3p, -16-5p, -7a-5p, and -17-5p in bromelain-treated CaCO2cells compared to in DLD-1 cells potentially targeted ACSL-4 and resulted in suppression of ACSL-4. Overall, bromelain inhibits proliferation of Kras mutant Colorectal Cancer (CRC) effectively via ACSL-4.
Ubiquitin carboxyl-terminal hydrolase BAP1 (BAP1) [Driver]
In total 1 item(s) under this target
Experiment 1 Reporting the Ferroptosis Target of This Regulator [2]
Target for Ferroptosis Driver
Responsed Disease Parkinson disease ICD-11: 8A00
Pathway Response Ferroptosis hsa04216
Cell Process Cell ferroptosis
In Vitro Model
SK-N-SH cells Neuroblastoma Homo sapiens CVCL_0531
Response regulation Dysregulated ferroptosis is closely associated with Parkinson's disease (PD) progression. NEAT1 functioned as a sponge to suppress miR-150-5p expression. Moreover, miR-150-5p overexpression suppressed ferroptosis in PD cell model. And miR-150-5p regulated SLC7A11 expression by directly binding to BAP1.
Sodium-coupled neutral amino acid symporter 1 (SLC38A1) [Driver]
In total 1 item(s) under this target
Experiment 1 Reporting the Ferroptosis Target of This Regulator [3]
Target for Ferroptosis Driver
Responsed Disease Pulmonary fibrosis ICD-11: CB03
Pathway Response Fatty acid metabolism hsa01212
Ferroptosis hsa04216
Cell Process Cell ferroptosis
Cell proliferation
Cell migration
In Vitro Model
HFL1 cells Normal Homo sapiens CVCL_0298
In Vivo Model
Male Sprague-Dawley rats (200-220 g) were purchased from Weitonglihua Company (Beijing, China) and maintained in a pathogen-free facility. After one week of adaptive feeding, a total of 30 rats were randomly divided into 3 groups (n = 10 rats/group): a control group; bleomycin (BLM) group; and BLM + sh-ZFAS1 group. Rats in the BLM group were administered 5 mg/kg BLM (Nippon Kayaku, Japan) dissolved in phosphate buffered saline (PBS) and administered to the rats intratracheally to establish the PF model. Rats in the control group were treated with 0.05 mL PBS. Rats in the BLM + sh-ZFAS1 group were injected intraperitoneally with 30 uL lncRNA ZFAS1 shRNA adeno-associated virus 5 (Vigene Biosciences, USA) for 3 weeks prior to an injection of 5 mg/kg BLM sulfate.

    Click to Show/Hide
Response regulation Inhibition of lncRNA ZFAS1 abolished BLM-induced lipid peroxidation and pulmonary fibrosis (PF) development. Mechanistically, silencing of lncRNA ZFAS1 attenuated ferroptosis and PF progression by lncRNA ZFAS1 acting as a competing endogenous RNA (ceRNA) and sponging miR-150-5p to downregulate SLC38A1 expression.
Phospholipid hydroperoxide glutathione peroxidase (GPX4) [Suppressor]
In total 1 item(s) under this target
Experiment 1 Reporting the Ferroptosis Target of This Regulator [4]
Target for Ferroptosis Suppressor
Responsed Disease Cardiomyopathy ICD-11: BC43
Pathway Response Fatty acid metabolism hsa01212
Ferroptosis hsa04216
Cell Process Cell ferroptosis
Cell apoptosis
In Vitro Model
hCMs (Human cardiomyocytes)
In Vivo Model
To simulate the animal model of diabetic cardiomyopathy, male db/+ mice and db/db mice (age, 7 weeks, weight, 24 g) were fed a normal diet for 4 weeks and kept at 24 under a 14-h light/8-h dark cycle. The animals were purchased from the Model Animal Research Center of Nanjing University (Nanjing, China). Diabetic mice were intracoronarily administered equal volumes (80 ul) of adenoviruses Ad-ZFAS1, Ad-sh-ZFAS1, Ad-CCND2, Ad-sh-CCND2 or Ad-NC.33 miR-150-5p mimics and mimic control (NC) were injected into the tail vein of mice (50 ug/kg) every 15 days for 12 weeks. Db/db mice were treated with or without ferrostatin-1 (Fer-1, ferroptosis inhibitor; Sigma-Aldrich, 5 mg/kg) for an additional 12 weeks.

    Click to Show/Hide
Response regulation lncRNA-ZFAS1 acted as a ceRNA to sponge miR-150-5p and downregulate CCND2 to promote cardiomyocyte ferroptosis and Diabetic cardiomyopathy development. Inhibition of ZFAS1 restored the expression of FTH1, reduced the expression of 4HNE, rescued the expression of GPX4 and inhibited the expression of apoptosisrelated genes.
Ferritin heavy chain (FTH1) [Suppressor; Marker]
In total 1 item(s) under this target
Experiment 1 Reporting the Ferroptosis Target of This Regulator [4]
Target for Ferroptosis Marker/Suppressor
Responsed Disease Cardiomyopathy ICD-11: BC43
Pathway Response Fatty acid metabolism hsa01212
Ferroptosis hsa04216
Cell Process Cell ferroptosis
Cell apoptosis
In Vitro Model
hCMs (Human cardiomyocytes)
In Vivo Model
To simulate the animal model of diabetic cardiomyopathy, male db/+ mice and db/db mice (age, 7 weeks, weight, 24 g) were fed a normal diet for 4 weeks and kept at 24 under a 14-h light/8-h dark cycle. The animals were purchased from the Model Animal Research Center of Nanjing University (Nanjing, China). Diabetic mice were intracoronarily administered equal volumes (80 ul) of adenoviruses Ad-ZFAS1, Ad-sh-ZFAS1, Ad-CCND2, Ad-sh-CCND2 or Ad-NC.33 miR-150-5p mimics and mimic control (NC) were injected into the tail vein of mice (50 ug/kg) every 15 days for 12 weeks. Db/db mice were treated with or without ferrostatin-1 (Fer-1, ferroptosis inhibitor; Sigma-Aldrich, 5 mg/kg) for an additional 12 weeks.

    Click to Show/Hide
Response regulation lncRNA-ZFAS1 acted as a ceRNA to sponge miR-150-5p and downregulate CCND2 to promote cardiomyocyte ferroptosis and Diabetic cardiomyopathy development. Inhibition of ZFAS1 restored the expression of FTH1, reduced the expression of 4HNE, rescued the expression of GPX4 and inhibited the expression of apoptosisrelated genes.
Colorectal cancer [ICD-11: 2B91]
In total 1 item(s) under this disease
Experiment 1 Reporting the Ferroptosis-centered Disease Response [1]
Target Regulator hsa-miR-150-5p (miRNA) miRNA
Responsed Drug Bromelain Investigative
Pathway Response Fatty acid metabolism hsa01212
Ferroptosis hsa04216
Cell Process Cell ferroptosis
Cell proliferation
In Vitro Model
NCI-H508 cells Cecum adenocarcinoma Homo sapiens CVCL_1564
HCT 116 cells Colon carcinoma Homo sapiens CVCL_0291
G13D (Human colorectal cancer cells)
DLD-1 cells Colon adenocarcinoma Homo sapiens CVCL_0248
G12D (Human colorectal cancer cells)
CCD-18Co cells Normal Homo sapiens CVCL_2379
In Vivo Model
Animals (n = 7) were given 2.5% DSS in drinking water for 5 days and then no treatment for 14 days as one cycle; this process was repeated for three cycles. In the last cycle, 2% DSS water treated to each group and no treatment for 14 days. During the three DSS cycle, 3 mg/kg bromelain were injected daily intraperitoneally and colon and spleen tissues were harvested after three DSS cycle in 57 days to study polyp burden and to perform histological staining.

    Click to Show/Hide
Response regulation Elevated miR-19b-3p, -130a-3p, -150-5p, -144-3p, -16-5p, -7a-5p, and -17-5p in bromelain-treated CaCO2cells compared to in DLD-1 cells potentially targeted ACSL-4 and resulted in suppression of ACSL-4. Overall, bromelain inhibits proliferation of Kras mutant Colorectal Cancer (CRC) effectively via ACSL-4.
Parkinson disease [ICD-11: 8A00]
In total 1 item(s) under this disease
Experiment 1 Reporting the Ferroptosis-centered Disease Response [2]
Target Regulator hsa-miR-150-5p (miRNA) miRNA
Pathway Response Ferroptosis hsa04216
Cell Process Cell ferroptosis
In Vitro Model
SK-N-SH cells Neuroblastoma Homo sapiens CVCL_0531
Response regulation Dysregulated ferroptosis is closely associated with Parkinson's disease (PD) progression. NEAT1 functioned as a sponge to suppress miR-150-5p expression. Moreover, miR-150-5p overexpression suppressed ferroptosis in PD cell model. And miR-150-5p regulated SLC7A11 expression by directly binding to BAP1.
Cardiomyopathy [ICD-11: BC43]
In total 2 item(s) under this disease
Experiment 1 Reporting the Ferroptosis-centered Disease Response [4]
Target Regulator hsa-miR-150-5p (miRNA) miRNA
Pathway Response Fatty acid metabolism hsa01212
Ferroptosis hsa04216
Cell Process Cell ferroptosis
Cell apoptosis
In Vitro Model
hCMs (Human cardiomyocytes)
In Vivo Model
To simulate the animal model of diabetic cardiomyopathy, male db/+ mice and db/db mice (age, 7 weeks, weight, 24 g) were fed a normal diet for 4 weeks and kept at 24 under a 14-h light/8-h dark cycle. The animals were purchased from the Model Animal Research Center of Nanjing University (Nanjing, China). Diabetic mice were intracoronarily administered equal volumes (80 ul) of adenoviruses Ad-ZFAS1, Ad-sh-ZFAS1, Ad-CCND2, Ad-sh-CCND2 or Ad-NC.33 miR-150-5p mimics and mimic control (NC) were injected into the tail vein of mice (50 ug/kg) every 15 days for 12 weeks. Db/db mice were treated with or without ferrostatin-1 (Fer-1, ferroptosis inhibitor; Sigma-Aldrich, 5 mg/kg) for an additional 12 weeks.

    Click to Show/Hide
Response regulation lncRNA-ZFAS1 acted as a ceRNA to sponge miR-150-5p and downregulate CCND2 to promote cardiomyocyte ferroptosis and Diabetic cardiomyopathy development. Inhibition of ZFAS1 restored the expression of FTH1, reduced the expression of 4HNE, rescued the expression of GPX4 and inhibited the expression of apoptosisrelated genes.
Experiment 2 Reporting the Ferroptosis-centered Disease Response [4]
Target Regulator hsa-miR-150-5p (miRNA) miRNA
Pathway Response Fatty acid metabolism hsa01212
Ferroptosis hsa04216
Cell Process Cell ferroptosis
Cell apoptosis
In Vitro Model
hCMs (Human cardiomyocytes)
In Vivo Model
To simulate the animal model of diabetic cardiomyopathy, male db/+ mice and db/db mice (age, 7 weeks, weight, 24 g) were fed a normal diet for 4 weeks and kept at 24 under a 14-h light/8-h dark cycle. The animals were purchased from the Model Animal Research Center of Nanjing University (Nanjing, China). Diabetic mice were intracoronarily administered equal volumes (80 ul) of adenoviruses Ad-ZFAS1, Ad-sh-ZFAS1, Ad-CCND2, Ad-sh-CCND2 or Ad-NC.33 miR-150-5p mimics and mimic control (NC) were injected into the tail vein of mice (50 ug/kg) every 15 days for 12 weeks. Db/db mice were treated with or without ferrostatin-1 (Fer-1, ferroptosis inhibitor; Sigma-Aldrich, 5 mg/kg) for an additional 12 weeks.

    Click to Show/Hide
Response regulation lncRNA-ZFAS1 acted as a ceRNA to sponge miR-150-5p and downregulate CCND2 to promote cardiomyocyte ferroptosis and Diabetic cardiomyopathy development. Inhibition of ZFAS1 restored the expression of FTH1, reduced the expression of 4HNE, rescued the expression of GPX4 and inhibited the expression of apoptosisrelated genes.
Pulmonary fibrosis [ICD-11: CB03]
In total 1 item(s) under this disease
Experiment 1 Reporting the Ferroptosis-centered Disease Response [3]
Target Regulator hsa-miR-150-5p (miRNA) miRNA
Pathway Response Fatty acid metabolism hsa01212
Ferroptosis hsa04216
Cell Process Cell ferroptosis
Cell proliferation
Cell migration
In Vitro Model
HFL1 cells Normal Homo sapiens CVCL_0298
In Vivo Model
Male Sprague-Dawley rats (200-220 g) were purchased from Weitonglihua Company (Beijing, China) and maintained in a pathogen-free facility. After one week of adaptive feeding, a total of 30 rats were randomly divided into 3 groups (n = 10 rats/group): a control group; bleomycin (BLM) group; and BLM + sh-ZFAS1 group. Rats in the BLM group were administered 5 mg/kg BLM (Nippon Kayaku, Japan) dissolved in phosphate buffered saline (PBS) and administered to the rats intratracheally to establish the PF model. Rats in the control group were treated with 0.05 mL PBS. Rats in the BLM + sh-ZFAS1 group were injected intraperitoneally with 30 uL lncRNA ZFAS1 shRNA adeno-associated virus 5 (Vigene Biosciences, USA) for 3 weeks prior to an injection of 5 mg/kg BLM sulfate.

    Click to Show/Hide
Response regulation Inhibition of lncRNA ZFAS1 abolished BLM-induced lipid peroxidation and pulmonary fibrosis (PF) development. Mechanistically, silencing of lncRNA ZFAS1 attenuated ferroptosis and PF progression by lncRNA ZFAS1 acting as a competing endogenous RNA (ceRNA) and sponging miR-150-5p to downregulate SLC38A1 expression.
Bromelain [Investigative]
In total 1 item(s) under this drug
Experiment 1 Reporting the Ferroptosis-centered Drug Response [1]
Drug for Ferroptosis Inducer
Response Target Long-chain-fatty-acid--CoA ligase 4 (ACSL4) Driver
Responsed Disease Colorectal cancer ICD-11: 2B91
Pathway Response Fatty acid metabolism hsa01212
Ferroptosis hsa04216
Cell Process Cell ferroptosis
Cell proliferation
In Vitro Model
NCI-H508 cells Cecum adenocarcinoma Homo sapiens CVCL_1564
HCT 116 cells Colon carcinoma Homo sapiens CVCL_0291
G13D (Human colorectal cancer cells)
DLD-1 cells Colon adenocarcinoma Homo sapiens CVCL_0248
G12D (Human colorectal cancer cells)
CCD-18Co cells Normal Homo sapiens CVCL_2379
In Vivo Model
Animals (n = 7) were given 2.5% DSS in drinking water for 5 days and then no treatment for 14 days as one cycle; this process was repeated for three cycles. In the last cycle, 2% DSS water treated to each group and no treatment for 14 days. During the three DSS cycle, 3 mg/kg bromelain were injected daily intraperitoneally and colon and spleen tissues were harvested after three DSS cycle in 57 days to study polyp burden and to perform histological staining.

    Click to Show/Hide
Response regulation Elevated miR-19b-3p, -130a-3p, -150-5p, -144-3p, -16-5p, -7a-5p, and -17-5p in bromelain-treated CaCO2cells compared to in DLD-1 cells potentially targeted ACSL-4 and resulted in suppression of ACSL-4. Overall, bromelain inhibits proliferation of Kras mutant Colorectal Cancer (CRC) effectively via ACSL-4.
References
Ref 1 Bromelain effectively suppresses Kras-mutant colorectal cancer by stimulating ferroptosis. Anim Cells Syst (Seoul). 2018 Aug 30;22(5):334-340. doi: 10.1080/19768354.2018.1512521. eCollection 2018.
Ref 2 LncRNA NEAT1 promoted MPP+induced ferroptosis via regulating miR1505p/BAP1 pathway in SKNSH cells. Acta Neurobiol Exp (Wars). 2022;82(2):226-236. doi: 10.55782/ane-2022-021.
Ref 3 lncRNA ZFAS1 promotes lung fibroblast-to-myofibroblast transition and ferroptosis via functioning as a ceRNA through miR-150-5p/SLC38A1 axis. Aging (Albany NY). 2020 May 26;12(10):9085-9102. doi: 10.18632/aging.103176. Epub 2020 May 26.
Ref 4 Inhibition of the long non-coding RNA ZFAS1 attenuates ferroptosis by sponging miR-150-5p and activates CCND2 against diabetic cardiomyopathy. J Cell Mol Med. 2021 Nov;25(21):9995-10007. doi: 10.1111/jcmm.16890. Epub 2021 Oct 5.