Ferroptosis Regulator Information

General Information of the Ferroptosis Regulator (ID: REG20016)
Regulator Name hsa-miR-34a-5p (miRNA)
Synonyms
hsa-miR-34a-5p
    Click to Show/Hide
Gene Name hsa-miR-34a-5p
Regulator Type miRNA
MiRBase ID MIMAT0000255
Sequence
UGGCAGUGUCUUAGCUGGUUGU

    Click to Show/Hide
Full List of the Ferroptosis Target of This Regulator and Corresponding Disease/Drug Response(s)
hsa-miR-34a-5p can regulate the following target(s), and cause disease/drug response(s). You can browse detail information of target(s) or disease/drug response(s).
Browse Target
Browse Disease
Browse Drug
Prostaglandin G/H synthase 2 (PTGS2) [Driver; Marker]
 Target Info 
In total 1 item(s) under this target
Experiment 1 Reporting the Ferroptosis Target of This Regulator [1]
Target for Ferroptosis Marker
Responsed Disease Kidney injury ICD-11: NB92
 Disease Info 
Responsed Drug Cadmium Investigative
 Drug Info 
Pathway Response Ferroptosis hsa04216
Apoptosis hsa04210
Cell Process Cell ferroptosis
Cell apoptosis
In Vitro Model
 PC12 cells Adrenal gland pheochromocytoma Rattus norvegicus CVCL_0481
Response regulation CdCl2-initiated injury was found to result from the induction of not only apoptosis but also ferroptosis, as evidenced by the increased iron content, ROS production, and mitochondrial membrane potential along with changes in the expressions of iron death-related genes (FTH1, GPX4, ASCL4, PTGS2, and NOX1) and levels of caspase9, Bax, and Bcl-2 proteins. It is possible that the damage caused by cadmium results from the induced ferroptosis and apoptosis via the miR-34a-5p/Sirt1 axis.
Phospholipid hydroperoxide glutathione peroxidase (GPX4) [Suppressor]
 Target Info 
In total 1 item(s) under this target
Experiment 1 Reporting the Ferroptosis Target of This Regulator [1]
Target for Ferroptosis Suppressor
Responsed Disease Kidney injury ICD-11: NB92
 Disease Info 
Responsed Drug Cadmium Investigative
 Drug Info 
Pathway Response Ferroptosis hsa04216
Apoptosis hsa04210
Cell Process Cell ferroptosis
Cell apoptosis
In Vitro Model
 PC12 cells Adrenal gland pheochromocytoma Rattus norvegicus CVCL_0481
Response regulation CdCl2-initiated injury was found to result from the induction of not only apoptosis but also ferroptosis, as evidenced by the increased iron content, ROS production, and mitochondrial membrane potential along with changes in the expressions of iron death-related genes (FTH1, GPX4, ASCL4, PTGS2, and NOX1) and levels of caspase9, Bax, and Bcl-2 proteins. It is possible that the damage caused by cadmium results from the induced ferroptosis and apoptosis via the miR-34a-5p/Sirt1 axis.
NADPH oxidase 1 (NOX1) [Driver]
 Target Info 
In total 1 item(s) under this target
Experiment 1 Reporting the Ferroptosis Target of This Regulator [1]
Target for Ferroptosis Driver
Responsed Disease Kidney injury ICD-11: NB92
 Disease Info 
Responsed Drug Cadmium Investigative
 Drug Info 
Pathway Response Ferroptosis hsa04216
Apoptosis hsa04210
Cell Process Cell ferroptosis
Cell apoptosis
In Vitro Model
 PC12 cells Adrenal gland pheochromocytoma Rattus norvegicus CVCL_0481
Response regulation CdCl2-initiated injury was found to result from the induction of not only apoptosis but also ferroptosis, as evidenced by the increased iron content, ROS production, and mitochondrial membrane potential along with changes in the expressions of iron death-related genes (FTH1, GPX4, ASCL4, PTGS2, and NOX1) and levels of caspase9, Bax, and Bcl-2 proteins. It is possible that the damage caused by cadmium results from the induced ferroptosis and apoptosis via the miR-34a-5p/Sirt1 axis.
Long-chain-fatty-acid--CoA ligase 4 (ACSL4) [Driver]
 Target Info 
In total 1 item(s) under this target
Experiment 1 Reporting the Ferroptosis Target of This Regulator [1]
Target for Ferroptosis Driver
Responsed Disease Kidney injury ICD-11: NB92
 Disease Info 
Responsed Drug Cadmium Investigative
 Drug Info 
Pathway Response Ferroptosis hsa04216
Apoptosis hsa04210
Cell Process Cell ferroptosis
Cell apoptosis
In Vitro Model
 PC12 cells Adrenal gland pheochromocytoma Rattus norvegicus CVCL_0481
Response regulation CdCl2-initiated injury was found to result from the induction of not only apoptosis but also ferroptosis, as evidenced by the increased iron content, ROS production, and mitochondrial membrane potential along with changes in the expressions of iron death-related genes (FTH1, GPX4, ASCL4, PTGS2, and NOX1) and levels of caspase9, Bax, and Bcl-2 proteins. It is possible that the damage caused by cadmium results from the induced ferroptosis and apoptosis via the miR-34a-5p/Sirt1 axis.
Ferritin heavy chain (FTH1) [Suppressor; Marker]
 Target Info 
In total 1 item(s) under this target
Experiment 1 Reporting the Ferroptosis Target of This Regulator [1]
Target for Ferroptosis Marker/Suppressor
Responsed Disease Kidney injury ICD-11: NB92
 Disease Info 
Responsed Drug Cadmium Investigative
 Drug Info 
Pathway Response Ferroptosis hsa04216
Apoptosis hsa04210
Cell Process Cell ferroptosis
Cell apoptosis
In Vitro Model
 PC12 cells Adrenal gland pheochromocytoma Rattus norvegicus CVCL_0481
Response regulation CdCl2-initiated injury was found to result from the induction of not only apoptosis but also ferroptosis, as evidenced by the increased iron content, ROS production, and mitochondrial membrane potential along with changes in the expressions of iron death-related genes (FTH1, GPX4, ASCL4, PTGS2, and NOX1) and levels of caspase9, Bax, and Bcl-2 proteins. It is possible that the damage caused by cadmium results from the induced ferroptosis and apoptosis via the miR-34a-5p/Sirt1 axis.
Kidney injury [ICD-11: NB92]
 Disease Info 
In total 5 item(s) under this disease
Experiment 1 Reporting the Ferroptosis-centered Disease Response [1]
Target Regulator hsa-miR-34a-5p (miRNA) miRNA
 Regulator Info 
Responsed Drug Cadmium Investigative
 Drug Info 
Pathway Response Ferroptosis hsa04216
Apoptosis hsa04210
Cell Process Cell ferroptosis
Cell apoptosis
In Vitro Model
 PC12 cells Adrenal gland pheochromocytoma Rattus norvegicus CVCL_0481
Response regulation CdCl2-initiated injury was found to result from the induction of not only apoptosis but also ferroptosis, as evidenced by the increased iron content, ROS production, and mitochondrial membrane potential along with changes in the expressions of iron death-related genes (FTH1, GPX4, ASCL4, PTGS2, and NOX1) and levels of caspase9, Bax, and Bcl-2 proteins. It is possible that the damage caused by cadmium results from the induced ferroptosis and apoptosis via the miR-34a-5p/Sirt1 axis.
Experiment 2 Reporting the Ferroptosis-centered Disease Response [1]
Target Regulator hsa-miR-34a-5p (miRNA) miRNA
 Regulator Info 
Responsed Drug Cadmium Investigative
 Drug Info 
Pathway Response Ferroptosis hsa04216
Apoptosis hsa04210
Cell Process Cell ferroptosis
Cell apoptosis
In Vitro Model
 PC12 cells Adrenal gland pheochromocytoma Rattus norvegicus CVCL_0481
Response regulation CdCl2-initiated injury was found to result from the induction of not only apoptosis but also ferroptosis, as evidenced by the increased iron content, ROS production, and mitochondrial membrane potential along with changes in the expressions of iron death-related genes (FTH1, GPX4, ASCL4, PTGS2, and NOX1) and levels of caspase9, Bax, and Bcl-2 proteins. It is possible that the damage caused by cadmium results from the induced ferroptosis and apoptosis via the miR-34a-5p/Sirt1 axis.
Experiment 3 Reporting the Ferroptosis-centered Disease Response [1]
Target Regulator hsa-miR-34a-5p (miRNA) miRNA
 Regulator Info 
Responsed Drug Cadmium Investigative
 Drug Info 
Pathway Response Ferroptosis hsa04216
Apoptosis hsa04210
Cell Process Cell ferroptosis
Cell apoptosis
In Vitro Model
 PC12 cells Adrenal gland pheochromocytoma Rattus norvegicus CVCL_0481
Response regulation CdCl2-initiated injury was found to result from the induction of not only apoptosis but also ferroptosis, as evidenced by the increased iron content, ROS production, and mitochondrial membrane potential along with changes in the expressions of iron death-related genes (FTH1, GPX4, ASCL4, PTGS2, and NOX1) and levels of caspase9, Bax, and Bcl-2 proteins. It is possible that the damage caused by cadmium results from the induced ferroptosis and apoptosis via the miR-34a-5p/Sirt1 axis.
Experiment 4 Reporting the Ferroptosis-centered Disease Response [1]
Target Regulator hsa-miR-34a-5p (miRNA) miRNA
 Regulator Info 
Responsed Drug Cadmium Investigative
 Drug Info 
Pathway Response Ferroptosis hsa04216
Apoptosis hsa04210
Cell Process Cell ferroptosis
Cell apoptosis
In Vitro Model
 PC12 cells Adrenal gland pheochromocytoma Rattus norvegicus CVCL_0481
Response regulation CdCl2-initiated injury was found to result from the induction of not only apoptosis but also ferroptosis, as evidenced by the increased iron content, ROS production, and mitochondrial membrane potential along with changes in the expressions of iron death-related genes (FTH1, GPX4, ASCL4, PTGS2, and NOX1) and levels of caspase9, Bax, and Bcl-2 proteins. It is possible that the damage caused by cadmium results from the induced ferroptosis and apoptosis via the miR-34a-5p/Sirt1 axis.
Experiment 5 Reporting the Ferroptosis-centered Disease Response [1]
Target Regulator hsa-miR-34a-5p (miRNA) miRNA
 Regulator Info 
Responsed Drug Cadmium Investigative
 Drug Info 
Pathway Response Ferroptosis hsa04216
Apoptosis hsa04210
Cell Process Cell ferroptosis
Cell apoptosis
In Vitro Model
 PC12 cells Adrenal gland pheochromocytoma Rattus norvegicus CVCL_0481
Response regulation CdCl2-initiated injury was found to result from the induction of not only apoptosis but also ferroptosis, as evidenced by the increased iron content, ROS production, and mitochondrial membrane potential along with changes in the expressions of iron death-related genes (FTH1, GPX4, ASCL4, PTGS2, and NOX1) and levels of caspase9, Bax, and Bcl-2 proteins. It is possible that the damage caused by cadmium results from the induced ferroptosis and apoptosis via the miR-34a-5p/Sirt1 axis.
Cadmium [Investigative]
 Drug Info 
In total 5 item(s) under this drug
Experiment 1 Reporting the Ferroptosis-centered Drug Response [1]
Drug for Ferroptosis Inducer
Response Target Prostaglandin G/H synthase 2 (PTGS2) Driver; Marker
 Target Info 
Responsed Disease Kidney injury ICD-11: NB92
 Disease Info 
Pathway Response Ferroptosis hsa04216
Apoptosis hsa04210
Cell Process Cell ferroptosis
Cell apoptosis
In Vitro Model
 PC12 cells Adrenal gland pheochromocytoma Rattus norvegicus CVCL_0481
Response regulation CdCl2-initiated injury was found to result from the induction of not only apoptosis but also ferroptosis, as evidenced by the increased iron content, ROS production, and mitochondrial membrane potential along with changes in the expressions of iron death-related genes (FTH1, GPX4, ASCL4, PTGS2, and NOX1) and levels of caspase9, Bax, and Bcl-2 proteins. It is possible that the damage caused by cadmium results from the induced ferroptosis and apoptosis via the miR-34a-5p/Sirt1 axis.
Experiment 2 Reporting the Ferroptosis-centered Drug Response [1]
Drug for Ferroptosis Inducer
Response Target Phospholipid hydroperoxide glutathione peroxidase (GPX4) Suppressor
 Target Info 
Responsed Disease Kidney injury ICD-11: NB92
 Disease Info 
Pathway Response Ferroptosis hsa04216
Apoptosis hsa04210
Cell Process Cell ferroptosis
Cell apoptosis
In Vitro Model
 PC12 cells Adrenal gland pheochromocytoma Rattus norvegicus CVCL_0481
Response regulation CdCl2-initiated injury was found to result from the induction of not only apoptosis but also ferroptosis, as evidenced by the increased iron content, ROS production, and mitochondrial membrane potential along with changes in the expressions of iron death-related genes (FTH1, GPX4, ASCL4, PTGS2, and NOX1) and levels of caspase9, Bax, and Bcl-2 proteins. It is possible that the damage caused by cadmium results from the induced ferroptosis and apoptosis via the miR-34a-5p/Sirt1 axis.
Experiment 3 Reporting the Ferroptosis-centered Drug Response [1]
Drug for Ferroptosis Inducer
Response Target NADPH oxidase 1 (NOX1) Driver
 Target Info 
Responsed Disease Kidney injury ICD-11: NB92
 Disease Info 
Pathway Response Ferroptosis hsa04216
Apoptosis hsa04210
Cell Process Cell ferroptosis
Cell apoptosis
In Vitro Model
 PC12 cells Adrenal gland pheochromocytoma Rattus norvegicus CVCL_0481
Response regulation CdCl2-initiated injury was found to result from the induction of not only apoptosis but also ferroptosis, as evidenced by the increased iron content, ROS production, and mitochondrial membrane potential along with changes in the expressions of iron death-related genes (FTH1, GPX4, ASCL4, PTGS2, and NOX1) and levels of caspase9, Bax, and Bcl-2 proteins. It is possible that the damage caused by cadmium results from the induced ferroptosis and apoptosis via the miR-34a-5p/Sirt1 axis.
Experiment 4 Reporting the Ferroptosis-centered Drug Response [1]
Drug for Ferroptosis Inducer
Response Target Long-chain-fatty-acid--CoA ligase 4 (ACSL4) Driver
 Target Info 
Responsed Disease Kidney injury ICD-11: NB92
 Disease Info 
Pathway Response Ferroptosis hsa04216
Apoptosis hsa04210
Cell Process Cell ferroptosis
Cell apoptosis
In Vitro Model
 PC12 cells Adrenal gland pheochromocytoma Rattus norvegicus CVCL_0481
Response regulation CdCl2-initiated injury was found to result from the induction of not only apoptosis but also ferroptosis, as evidenced by the increased iron content, ROS production, and mitochondrial membrane potential along with changes in the expressions of iron death-related genes (FTH1, GPX4, ASCL4, PTGS2, and NOX1) and levels of caspase9, Bax, and Bcl-2 proteins. It is possible that the damage caused by cadmium results from the induced ferroptosis and apoptosis via the miR-34a-5p/Sirt1 axis.
Experiment 5 Reporting the Ferroptosis-centered Drug Response [1]
Drug for Ferroptosis Inducer
Response Target Ferritin heavy chain (FTH1) Suppressor; Marker
 Target Info 
Responsed Disease Kidney injury ICD-11: NB92
 Disease Info 
Pathway Response Ferroptosis hsa04216
Apoptosis hsa04210
Cell Process Cell ferroptosis
Cell apoptosis
In Vitro Model
 PC12 cells Adrenal gland pheochromocytoma Rattus norvegicus CVCL_0481
Response regulation CdCl2-initiated injury was found to result from the induction of not only apoptosis but also ferroptosis, as evidenced by the increased iron content, ROS production, and mitochondrial membrane potential along with changes in the expressions of iron death-related genes (FTH1, GPX4, ASCL4, PTGS2, and NOX1) and levels of caspase9, Bax, and Bcl-2 proteins. It is possible that the damage caused by cadmium results from the induced ferroptosis and apoptosis via the miR-34a-5p/Sirt1 axis.
References
Ref 1 Cadmium induces ferroptosis and apoptosis by modulating miR-34a-5p/Sirt1axis in PC12 cells. Environ Toxicol. 2022 Jan;37(1):41-51. doi: 10.1002/tox.23376. Epub 2021 Sep 24.