Ferroptosis Regulator Information

General Information of the Ferroptosis Regulator (ID: REG50014)
Regulator Name hsa-mir-522 (Precursor RNA)
Synonyms
hsa-mir-522
    Click to Show/Hide
Gene Name hsa-mir-522
Regulator Type Precursor RNA
MiRBase ID MI0003177
Sequence
UCUCAGGCUGUGUCCCUCUAGAGGGAAGCGCUUUCUGUUGUCUGAAAGAAAAGAAAAUGG
UUCCCUUUAGAGUGUUACGCUUUGAGA

    Click to Show/Hide
Full List of the Ferroptosis Target of This Regulator and Corresponding Disease/Drug Response(s)
hsa-mir-522 can regulate the following target(s), and cause disease/drug response(s). You can browse detail information of target(s) or disease/drug response(s).
Browse Target
Browse Disease
Browse Drug
Polyunsaturated fatty acid lipoxygenase ALOX15 (ALOX15) [Driver]
 Target Info 
In total 2 item(s) under this target
Experiment 1 Reporting the Ferroptosis Target of This Regulator [1]
Target for Ferroptosis Driver
Responsed Disease Gastric cancer ICD-11: 2B72
 Disease Info 
Responsed Drug Cisplatin Investigative
 Drug Info 
Pathway Response Fatty acid metabolism hsa01212
Cell Process Cell ferroptosis
Cell proliferation
In Vitro Model
 SGC-7901 cells Gastric carcinoma Homo sapiens CVCL_0520
MGC-803 cells Gastric mucinous adenocarcinoma Homo sapiens CVCL_5334
MKN45 cells Gastric adenocarcinoma Homo sapiens CVCL_0434
In Vivo Model
Male nude mice (BALB/c-nu, 6B8 weeks) were housed in a pathogen free animal facility with access to water and food, and allowed to eat and drink adlibitum. 5 x 105 SGC7901 cells and CAFs were injected subcutaneously for one mouse. These tumor-implanted mice were injected with either cisplatin (5 ug/g) or saline every 5 days since the day ten, and were sacrificed and tumors were removed at the 30th Day.

    Click to Show/Hide
Response regulation Cisplatin and paclitaxel promote miR-522 secretion from CAFs by activating USP7/hnRNPA1 axis, leading to ALOX15 suppression and decreased lipid-ROS accumulation in cancer cells, and ultimately result in decreased chemo-sensitivity. The intercellular pathway, comprising USP7, hnRNPA1, exo-miR-522 and ALOX15, reveals new mechanism of acquired chemo-resistance in gastric cancer.
Experiment 2 Reporting the Ferroptosis Target of This Regulator [1]
Target for Ferroptosis Driver
Responsed Disease Gastric cancer ICD-11: 2B72
 Disease Info 
Responsed Drug Paclitaxel Investigative
 Drug Info 
Pathway Response Fatty acid metabolism hsa01212
Cell Process Cell ferroptosis
Cell proliferation
In Vitro Model
 SGC-7901 cells Gastric carcinoma Homo sapiens CVCL_0520
MGC-803 cells Gastric mucinous adenocarcinoma Homo sapiens CVCL_5334
MKN45 cells Gastric adenocarcinoma Homo sapiens CVCL_0434
In Vivo Model
Male nude mice (BALB/c-nu, 6B8 weeks) were housed in a pathogen free animal facility with access to water and food, and allowed to eat and drink adlibitum. 5 x 105 SGC7901 cells and CAFs were injected subcutaneously for one mouse. These tumor-implanted mice were injected with either cisplatin (5 ug/g) or saline every 5 days since the day ten, and were sacrificed and tumors were removed at the 30th Day.

    Click to Show/Hide
Response regulation Cisplatin and paclitaxel promote miR-522 secretion from CAFs by activating USP7/hnRNPA1 axis, leading to ALOX15 suppression and decreased lipid-ROS accumulation in cancer cells, and ultimately result in decreased chemo-sensitivity. The intercellular pathway, comprising USP7, hnRNPA1, exo-miR-522 and ALOX15, reveals new mechanism of acquired chemo-resistance in gastric cancer.
Gastric cancer [ICD-11: 2B72]
 Disease Info 
In total 2 item(s) under this disease
Experiment 1 Reporting the Ferroptosis-centered Disease Response [1]
Target Regulator hsa-mir-522 (Precursor RNA) Precursor RNA
 Regulator Info 
Responsed Drug Cisplatin Investigative
 Drug Info 
Pathway Response Fatty acid metabolism hsa01212
Cell Process Cell ferroptosis
Cell proliferation
In Vitro Model
 SGC-7901 cells Gastric carcinoma Homo sapiens CVCL_0520
MGC-803 cells Gastric mucinous adenocarcinoma Homo sapiens CVCL_5334
MKN45 cells Gastric adenocarcinoma Homo sapiens CVCL_0434
In Vivo Model
Male nude mice (BALB/c-nu, 6B8 weeks) were housed in a pathogen free animal facility with access to water and food, and allowed to eat and drink adlibitum. 5 x 105 SGC7901 cells and CAFs were injected subcutaneously for one mouse. These tumor-implanted mice were injected with either cisplatin (5 ug/g) or saline every 5 days since the day ten, and were sacrificed and tumors were removed at the 30th Day.

    Click to Show/Hide
Response regulation Cisplatin and paclitaxel promote miR-522 secretion from CAFs by activating USP7/hnRNPA1 axis, leading to ALOX15 suppression and decreased lipid-ROS accumulation in cancer cells, and ultimately result in decreased chemo-sensitivity. The intercellular pathway, comprising USP7, hnRNPA1, exo-miR-522 and ALOX15, reveals new mechanism of acquired chemo-resistance in gastric cancer.
Experiment 2 Reporting the Ferroptosis-centered Disease Response [1]
Target Regulator hsa-mir-522 (Precursor RNA) Precursor RNA
 Regulator Info 
Responsed Drug Paclitaxel Investigative
 Drug Info 
Pathway Response Fatty acid metabolism hsa01212
Cell Process Cell ferroptosis
Cell proliferation
In Vitro Model
 SGC-7901 cells Gastric carcinoma Homo sapiens CVCL_0520
MGC-803 cells Gastric mucinous adenocarcinoma Homo sapiens CVCL_5334
MKN45 cells Gastric adenocarcinoma Homo sapiens CVCL_0434
In Vivo Model
Male nude mice (BALB/c-nu, 6B8 weeks) were housed in a pathogen free animal facility with access to water and food, and allowed to eat and drink adlibitum. 5 x 105 SGC7901 cells and CAFs were injected subcutaneously for one mouse. These tumor-implanted mice were injected with either cisplatin (5 ug/g) or saline every 5 days since the day ten, and were sacrificed and tumors were removed at the 30th Day.

    Click to Show/Hide
Response regulation Cisplatin and paclitaxel promote miR-522 secretion from CAFs by activating USP7/hnRNPA1 axis, leading to ALOX15 suppression and decreased lipid-ROS accumulation in cancer cells, and ultimately result in decreased chemo-sensitivity. The intercellular pathway, comprising USP7, hnRNPA1, exo-miR-522 and ALOX15, reveals new mechanism of acquired chemo-resistance in gastric cancer.
Cisplatin [Investigative]
 Drug Info 
In total 1 item(s) under this drug
Experiment 1 Reporting the Ferroptosis-centered Drug Response [1]
Drug for Ferroptosis Suppressor
Response Target Polyunsaturated fatty acid lipoxygenase ALOX15 (ALOX15) Driver
 Target Info 
Responsed Disease Gastric cancer ICD-11: 2B72
 Disease Info 
Pathway Response Fatty acid metabolism hsa01212
Cell Process Cell ferroptosis
Cell proliferation
In Vitro Model
 SGC-7901 cells Gastric carcinoma Homo sapiens CVCL_0520
MGC-803 cells Gastric mucinous adenocarcinoma Homo sapiens CVCL_5334
MKN45 cells Gastric adenocarcinoma Homo sapiens CVCL_0434
In Vivo Model
Male nude mice (BALB/c-nu, 6B8 weeks) were housed in a pathogen free animal facility with access to water and food, and allowed to eat and drink adlibitum. 5 x 105 SGC7901 cells and CAFs were injected subcutaneously for one mouse. These tumor-implanted mice were injected with either cisplatin (5 ug/g) or saline every 5 days since the day ten, and were sacrificed and tumors were removed at the 30th Day.

    Click to Show/Hide
Response regulation Cisplatin and paclitaxel promote miR-522 secretion from CAFs by activating USP7/hnRNPA1 axis, leading to ALOX15 suppression and decreased lipid-ROS accumulation in cancer cells, and ultimately result in decreased chemo-sensitivity. The intercellular pathway, comprising USP7, hnRNPA1, exo-miR-522 and ALOX15, reveals new mechanism of acquired chemo-resistance in gastric cancer.
Paclitaxel [Investigative]
 Drug Info 
In total 1 item(s) under this drug
Experiment 1 Reporting the Ferroptosis-centered Drug Response [1]
Drug for Ferroptosis Suppressor
Response Target Polyunsaturated fatty acid lipoxygenase ALOX15 (ALOX15) Driver
 Target Info 
Responsed Disease Gastric cancer ICD-11: 2B72
 Disease Info 
Pathway Response Fatty acid metabolism hsa01212
Cell Process Cell ferroptosis
Cell proliferation
In Vitro Model
 SGC-7901 cells Gastric carcinoma Homo sapiens CVCL_0520
MGC-803 cells Gastric mucinous adenocarcinoma Homo sapiens CVCL_5334
MKN45 cells Gastric adenocarcinoma Homo sapiens CVCL_0434
In Vivo Model
Male nude mice (BALB/c-nu, 6B8 weeks) were housed in a pathogen free animal facility with access to water and food, and allowed to eat and drink adlibitum. 5 x 105 SGC7901 cells and CAFs were injected subcutaneously for one mouse. These tumor-implanted mice were injected with either cisplatin (5 ug/g) or saline every 5 days since the day ten, and were sacrificed and tumors were removed at the 30th Day.

    Click to Show/Hide
Response regulation Cisplatin and paclitaxel promote miR-522 secretion from CAFs by activating USP7/hnRNPA1 axis, leading to ALOX15 suppression and decreased lipid-ROS accumulation in cancer cells, and ultimately result in decreased chemo-sensitivity. The intercellular pathway, comprising USP7, hnRNPA1, exo-miR-522 and ALOX15, reveals new mechanism of acquired chemo-resistance in gastric cancer.
References
Ref 1 CAF secreted miR-522 suppresses ferroptosis and promotes acquired chemo-resistance in gastric cancer. Mol Cancer. 2020 Feb 27;19(1):43. doi: 10.1186/s12943-020-01168-8.