General Information of the Ferroptosis Regulator (ID: REG20070)
Regulator Name hsa-miR-30b-5p (miRNA)
Synonyms
hsa-miR-30b-5p
    Click to Show/Hide
Gene Name hsa-miR-30b-5p
Regulator Type miRNA
MiRBase ID MIMAT0000420
Sequence
UGUAAACAUCCUACACUCAGCU

    Click to Show/Hide
Full List of the Ferroptosis Target of This Regulator and Corresponding Disease/Drug Response(s)
hsa-miR-30b-5p can regulate the following target(s), and cause disease/drug response(s). You can browse detail information of target(s) or disease/drug response(s).
Browse Target
Browse Disease
Transferrin receptor protein 1 (TFRC) [Driver; Suppressor; Marker]
In total 1 item(s) under this target
Experiment 1 Reporting the Ferroptosis Target of This Regulator [1]
Target for Ferroptosis Marker/Suppressor/Driver
Responsed Disease Cardiac hypertrophy ICD-11: BC45
Pathway Response Fatty acid metabolism hsa01212
Ferroptosis hsa04216
Cell Process Cell ferroptosis
Cell proliferation
In Vitro Model
hNCs (Neutrophils cells)
rCMECs (Rat cardiac microvascular endothelial cells)
In Vivo Model
The rats were randomly divided into five groups as follows: (1) sham group: the rats underwent sham operation and received vehicle (PBS, caudal vein injection). (2) Model group: the rats were subjected to AAC and received vehicle (PBS, caudal vein injection). (3-5) The treatment groups: the rats were subjected to AAC and after 24 h treated with si-AAB, si-AAB + MSN, or NM + si-AAB + MSN (50 nM siRNA dose per rat every 2 days for 4 weeks, caudal vein injection).

    Click to Show/Hide
Response regulation LncRNA AAB was upregulated in the hearts of cardiac hypertrophy rats as well as in the Ang II-induced CMECs. Importantly, we found that lncRNA AAB sponged and sequestered miR-30b-5p to induce the imbalance of MMP9/TIMP1, which enhanced the activation of transferrin receptor 1 (TFR-1) and then eventually led to the ferroptosis of CMECs.
Solute carrier family 40 member 1 (SLC40A1) [Suppressor; Marker]
In total 1 item(s) under this target
Experiment 1 Reporting the Ferroptosis Target of This Regulator [2]
Target for Ferroptosis Suppressor
Responsed Disease Preeclampsia ICD-11: JA24
Pathway Response Fatty acid metabolism hsa01212
Ferroptosis hsa04216
Cell Process Cell ferroptosis
In Vitro Model
HTR-8/SVneo cells Normal Homo sapiens CVCL_7162
hETCs (Human first-trimester extravillous trophoblast cells)
In Vivo Model
Pregnant SD rats were randomly dived into four groups: sham group (n = 8), PE group (n = 8), PE + ferrostatin-1 group ( n= 8), and PE + miR-30b-5p inhibition group (n = 8). On day 14 of pregnancy, PE rat model was established through reduced uterine perfusion pressure (RUPP) surgery, wherein constrictive silver clips were placed on the aorta (0.203-mm clips) superior to the iliac bifurcation and on the ovarian vessels (0.100-mm clips), according to a previous description. Sham rats were operated on in a fashion similar to that of RUPP rats, but without clipping. Mini-pumps were also intraperitoneally inserted into rats on day 14 of pregnancy. The mini-pump in each rat delivered the ferrostatin-1 at a dose of 10 umol/kg/day for 5 days. An miR-30b-5p antagonist (GenePharma) was injected from the tail veins on day 13 of gestation, at a rate of 100 uL/day for 6 days. The blood pressure was measured on days 14, 16, and 19 of gestation using catheters inserted into the carotid artery and jugular vein.

    Click to Show/Hide
Response regulation Abnormally up-regulated miR-30b-5p triggered the ferroptosis in trophoblasts under hypoxic conditions by down-regulating SLC7A11, Pax3, and Pax3-downstream target, FPN1. Blockage of miR-30b-5p up-regulation or direct inhibition of ferroptosis attenuated preeclampsia (PE) symptoms in the rat model, making miR-30b-5p a potential therapeutic target for preeclampsia.
Cystine/glutamate transporter (SLC7A11) [Driver; Suppressor]
In total 1 item(s) under this target
Experiment 1 Reporting the Ferroptosis Target of This Regulator [2]
Target for Ferroptosis Suppressor
Responsed Disease Preeclampsia ICD-11: JA24
Pathway Response Fatty acid metabolism hsa01212
Ferroptosis hsa04216
Cell Process Cell ferroptosis
In Vitro Model
HTR-8/SVneo cells Normal Homo sapiens CVCL_7162
hETCs (Human first-trimester extravillous trophoblast cells)
In Vivo Model
Pregnant SD rats were randomly dived into four groups: sham group (n = 8), PE group (n = 8), PE + ferrostatin-1 group ( n= 8), and PE + miR-30b-5p inhibition group (n = 8). On day 14 of pregnancy, PE rat model was established through reduced uterine perfusion pressure (RUPP) surgery, wherein constrictive silver clips were placed on the aorta (0.203-mm clips) superior to the iliac bifurcation and on the ovarian vessels (0.100-mm clips), according to a previous description. Sham rats were operated on in a fashion similar to that of RUPP rats, but without clipping. Mini-pumps were also intraperitoneally inserted into rats on day 14 of pregnancy. The mini-pump in each rat delivered the ferrostatin-1 at a dose of 10 umol/kg/day for 5 days. An miR-30b-5p antagonist (GenePharma) was injected from the tail veins on day 13 of gestation, at a rate of 100 uL/day for 6 days. The blood pressure was measured on days 14, 16, and 19 of gestation using catheters inserted into the carotid artery and jugular vein.

    Click to Show/Hide
Response regulation Abnormally up-regulated miR-30b-5p triggered the ferroptosis in trophoblasts under hypoxic conditions by down-regulating SLC7A11, Pax3, and Pax3-downstream target, FPN1. Blockage of miR-30b-5p up-regulation or direct inhibition of ferroptosis attenuated preeclampsia (PE) symptoms in the rat model, making miR-30b-5p a potential therapeutic target for preeclampsia.
Cardiac hypertrophy [ICD-11: BC45]
In total 1 item(s) under this disease
Experiment 1 Reporting the Ferroptosis-centered Disease Response [1]
Target Regulator hsa-miR-30b-5p (miRNA) miRNA
Pathway Response Fatty acid metabolism hsa01212
Ferroptosis hsa04216
Cell Process Cell ferroptosis
Cell proliferation
In Vitro Model
hNCs (Neutrophils cells)
rCMECs (Rat cardiac microvascular endothelial cells)
In Vivo Model
The rats were randomly divided into five groups as follows: (1) sham group: the rats underwent sham operation and received vehicle (PBS, caudal vein injection). (2) Model group: the rats were subjected to AAC and received vehicle (PBS, caudal vein injection). (3-5) The treatment groups: the rats were subjected to AAC and after 24 h treated with si-AAB, si-AAB + MSN, or NM + si-AAB + MSN (50 nM siRNA dose per rat every 2 days for 4 weeks, caudal vein injection).

    Click to Show/Hide
Response regulation LncRNA AAB was upregulated in the hearts of cardiac hypertrophy rats as well as in the Ang II-induced CMECs. Importantly, we found that lncRNA AAB sponged and sequestered miR-30b-5p to induce the imbalance of MMP9/TIMP1, which enhanced the activation of transferrin receptor 1 (TFR-1) and then eventually led to the ferroptosis of CMECs.
Preeclampsia [ICD-11: JA24]
In total 2 item(s) under this disease
Experiment 1 Reporting the Ferroptosis-centered Disease Response [2]
Target Regulator hsa-miR-30b-5p (miRNA) miRNA
Pathway Response Fatty acid metabolism hsa01212
Ferroptosis hsa04216
Cell Process Cell ferroptosis
In Vitro Model
HTR-8/SVneo cells Normal Homo sapiens CVCL_7162
hETCs (Human first-trimester extravillous trophoblast cells)
In Vivo Model
Pregnant SD rats were randomly dived into four groups: sham group (n = 8), PE group (n = 8), PE + ferrostatin-1 group ( n= 8), and PE + miR-30b-5p inhibition group (n = 8). On day 14 of pregnancy, PE rat model was established through reduced uterine perfusion pressure (RUPP) surgery, wherein constrictive silver clips were placed on the aorta (0.203-mm clips) superior to the iliac bifurcation and on the ovarian vessels (0.100-mm clips), according to a previous description. Sham rats were operated on in a fashion similar to that of RUPP rats, but without clipping. Mini-pumps were also intraperitoneally inserted into rats on day 14 of pregnancy. The mini-pump in each rat delivered the ferrostatin-1 at a dose of 10 umol/kg/day for 5 days. An miR-30b-5p antagonist (GenePharma) was injected from the tail veins on day 13 of gestation, at a rate of 100 uL/day for 6 days. The blood pressure was measured on days 14, 16, and 19 of gestation using catheters inserted into the carotid artery and jugular vein.

    Click to Show/Hide
Response regulation Abnormally up-regulated miR-30b-5p triggered the ferroptosis in trophoblasts under hypoxic conditions by down-regulating SLC7A11, Pax3, and Pax3-downstream target, FPN1. Blockage of miR-30b-5p up-regulation or direct inhibition of ferroptosis attenuated preeclampsia (PE) symptoms in the rat model, making miR-30b-5p a potential therapeutic target for preeclampsia.
Experiment 2 Reporting the Ferroptosis-centered Disease Response [2]
Target Regulator hsa-miR-30b-5p (miRNA) miRNA
Pathway Response Fatty acid metabolism hsa01212
Ferroptosis hsa04216
Cell Process Cell ferroptosis
In Vitro Model
HTR-8/SVneo cells Normal Homo sapiens CVCL_7162
hETCs (Human first-trimester extravillous trophoblast cells)
In Vivo Model
Pregnant SD rats were randomly dived into four groups: sham group (n = 8), PE group (n = 8), PE + ferrostatin-1 group ( n= 8), and PE + miR-30b-5p inhibition group (n = 8). On day 14 of pregnancy, PE rat model was established through reduced uterine perfusion pressure (RUPP) surgery, wherein constrictive silver clips were placed on the aorta (0.203-mm clips) superior to the iliac bifurcation and on the ovarian vessels (0.100-mm clips), according to a previous description. Sham rats were operated on in a fashion similar to that of RUPP rats, but without clipping. Mini-pumps were also intraperitoneally inserted into rats on day 14 of pregnancy. The mini-pump in each rat delivered the ferrostatin-1 at a dose of 10 umol/kg/day for 5 days. An miR-30b-5p antagonist (GenePharma) was injected from the tail veins on day 13 of gestation, at a rate of 100 uL/day for 6 days. The blood pressure was measured on days 14, 16, and 19 of gestation using catheters inserted into the carotid artery and jugular vein.

    Click to Show/Hide
Response regulation Abnormally up-regulated miR-30b-5p triggered the ferroptosis in trophoblasts under hypoxic conditions by down-regulating SLC7A11, Pax3, and Pax3-downstream target, FPN1. Blockage of miR-30b-5p up-regulation or direct inhibition of ferroptosis attenuated preeclampsia (PE) symptoms in the rat model, making miR-30b-5p a potential therapeutic target for preeclampsia.
References
Ref 1 Neutrophil-like cell membrane-coated siRNA of lncRNA AABR07017145.1 therapy for cardiac hypertrophy via inhibiting ferroptosis of CMECs. Mol Ther Nucleic Acids. 2021 Nov 3;27:16-36. doi: 10.1016/j.omtn.2021.10.024. eCollection 2022 Mar 8.
Ref 2 miR-30-5p-mediated ferroptosis of trophoblasts is implicated in the pathogenesis of preeclampsia. Redox Biol. 2020 Jan;29:101402. doi: 10.1016/j.redox.2019.101402. Epub 2019 Dec 9.