General Information of the Ferroptosis Regulator (ID: REG20014)
Regulator Name hsa-miR-7-5p (miRNA)
Synonyms
hsa-miR-7-5p
    Click to Show/Hide
Gene Name hsa-miR-7-5p
Regulator Type miRNA
MiRBase ID MIMAT0000252
Sequence
UGGAAGACUAGUGAUUUUGUUGUU

    Click to Show/Hide
Full List of the Ferroptosis Target of This Regulator and Corresponding Disease/Drug Response(s)
hsa-miR-7-5p can regulate the following target(s), and cause disease/drug response(s). You can browse detail information of target(s) or disease/drug response(s).
Browse Target
Browse Disease
Browse Drug
Transferrin receptor protein 1 (TFRC) [Driver; Suppressor; Marker]
In total 2 item(s) under this target
Experiment 1 Reporting the Ferroptosis Target of This Regulator [1]
Target for Ferroptosis Marker/Suppressor/Driver
Responsed Disease Cardiomyopathy ICD-11: BC43
Responsed Drug Doxorubicin Investigative
Pathway Response Fatty acid metabolism hsa01212
Ferroptosis hsa04216
Cell Process Cell ferroptosis
Cell proliferation
In Vitro Model
AC16 [Human hybrid cardiomyocyte] cells Normal Homo sapiens CVCL_4U18
In Vivo Model
Male Sprague-Dawley rats (6-8 weeks old; weighed from 210 to 230 g) were purchased from HFK Bioscience Co. Ltd. Rats were randomly assigned to four groups (n = 6 per group). The first was the control group, which were treated daily with 0.5 ml of 0.9% saline by intraperitoneal injection for 14 days, and there were three DOX model groups, which were treated three times weekly with 2.5 mg/kg of DOX by intraperitoneal injection for 14 weeks. At day 14, mice in the DOX model groups were infected through an intramyocardial injection of either control shNC or shMettl14 (1 x 109 titer) at three distinct locations in the left ventricular free wall three times a week for 2 weeks, and they were treated daily with 30 mg/kg of ferroptosis inducer erastin (MedChemExpress, USA) through intragastric administration or vehicle control (Saline) for 2 weeks.

    Click to Show/Hide
Response regulation Doxorubicin treatment resulted in the upregulation of methyltransferase-like 14 (METTL14), which catalyzes the m6A modification of the long non-coding RNA KCNQ1OT1, a miR-7-5p sponge. And miR-7-5p inhibits DOX-induced ferroptosis in cardiomyocytes by directly repressing TFRC. Inhibiting ferroptosis mediated by a METTL14/KCNQ1OT1/miR-7-5p positive feedback loop in cardiomyocytes could provide a new therapeutic approach to control DOX-induced cardiac injury.
Experiment 2 Reporting the Ferroptosis Target of This Regulator [1]
Target for Ferroptosis Marker/Suppressor/Driver
Responsed Disease Cardiomyopathy ICD-11: BC43
Pathway Response Fatty acid metabolism hsa01212
Ferroptosis hsa04216
Cell Process Cell ferroptosis
In Vitro Model
AC16 [Human hybrid cardiomyocyte] cells Normal Homo sapiens CVCL_4U18
In Vivo Model
Male Sprague-Dawley rats (6-8 weeks old; weighed from 210 to 230 g) were purchased from HFK Bioscience Co. Ltd. Rats were randomly assigned to four groups (n = 6 per group). The first was the control group, which were treated daily with 0.5 ml of 0.9% saline by intraperitoneal injection for 14 days, and there were three DOX model groups, which were treated three times weekly with 2.5 mg/kg of DOX by intraperitoneal injection for 14 weeks. At day 14, mice in the DOX model groups were infected through an intramyocardial injection of either control shNC or shMettl14 (1 x 109 titer) at three distinct locations in the left ventricular free wall three times a week for 2 weeks, and they were treated daily with 30 mg/kg of ferroptosis inducer erastin (MedChemExpress, USA) through intragastric administration or vehicle control (Saline) for 2 weeks.

    Click to Show/Hide
Response regulation The RNA-binding protein IGF2BP1 is associated with KCNQ1OT1 to increase its stability and robustly inhibit miR-7-5p activity. MiR-7-5p could effectively suppress METLL14 and TFRC expression. The study suggested a therapeutic strategy to alleviate doxorubicin (DOX)-induced cardiomyopathy.
Polyunsaturated fatty acid lipoxygenase ALOX12 (ALOX12) [Driver]
In total 1 item(s) under this target
Experiment 1 Reporting the Ferroptosis Target of This Regulator [2]
Target for Ferroptosis Driver
Responsed Disease Cervical cancer ICD-11: 2C77
Pathway Response Fatty acid metabolism hsa01212
Cell Process Cell ferroptosis
In Vitro Model
HeLa cells Endocervical adenocarcinoma Homo sapiens CVCL_0030
SAS cells Tongue squamous cell carcinoma Homo sapiens CVCL_1675
Response regulation Knockdown of miR-7-5p increased reactive oxygen species (ROS), mitochondrial membrane potential, and intracellular Fe2+amount. Furthermore, miR-7-5p knockdown results in the down-regulation of the iron storage gene expression such as ferritin, up-regulation of the ferroptosis marker ALOX12 gene expression, and increases of Liperfluo amount in Endocervical adenocarcinoma.
Long-chain-fatty-acid--CoA ligase 4 (ACSL4) [Driver]
In total 1 item(s) under this target
Experiment 1 Reporting the Ferroptosis Target of This Regulator [3]
Target for Ferroptosis Driver
Responsed Disease Retinopathy ICD-11: 9B71
Pathway Response Ferroptosis hsa04216
Cell Process Cell ferroptosis
In Vitro Model
hRECs (Human retinal endothelial cells)
In Vivo Model
For in vivo experiments, the eyes in each group (n = 6) were enucleated carefully and processed for indirect immunofluorescence in whole-mount or cross-section as previously described. For cryosections, the eyes (n = 3 retinae from 3 mice) were fixed in 4% PFA at room temperature for 15 min. The frozen samples were then sliced transversely (6 um) at -20. For retinal flat-mounts, the eyes (n = 3 eyes from 3 mice) were fixed in 4% PFA at room temperature for 15 min, and the retinae were dissected out as cups. Both cryosections and retinal cups were blocked with PBS containing 0.5% Triton-X100 and 5% BSA at 4 overnight and included with the anti-CD31 and anti-GPX4 (1:100, ab125066, Abcam) primary antibodies.

    Click to Show/Hide
Response regulation ZFAS1 may act as a competing endogenous RNA by competitively binding with microRNA-7-5p (miR-7-5p) and modulating the expression of its downstream molecule acyl-CoA synthetase long-chain family member 4 (ACSL4), which is now identified as a classic driver gene of ferroptosis process. In conclusion, our results demonstrate that HG-induced ZFAS1 elevation activates ferroptosis in hRECs and the ZFAS1/ miR-7-5p/ACSL4 axis may serve as a therapeutic target for endothelial dysfunction in diabetic retinopathy.
Cardiomyopathy [ICD-11: BC43]
In total 2 item(s) under this disease
Experiment 1 Reporting the Ferroptosis-centered Disease Response [1]
Target Regulator hsa-miR-7-5p (miRNA) miRNA
Responsed Drug Doxorubicin Investigative
Pathway Response Fatty acid metabolism hsa01212
Ferroptosis hsa04216
Cell Process Cell ferroptosis
Cell proliferation
In Vitro Model
AC16 [Human hybrid cardiomyocyte] cells Normal Homo sapiens CVCL_4U18
In Vivo Model
Male Sprague-Dawley rats (6-8 weeks old; weighed from 210 to 230 g) were purchased from HFK Bioscience Co. Ltd. Rats were randomly assigned to four groups (n = 6 per group). The first was the control group, which were treated daily with 0.5 ml of 0.9% saline by intraperitoneal injection for 14 days, and there were three DOX model groups, which were treated three times weekly with 2.5 mg/kg of DOX by intraperitoneal injection for 14 weeks. At day 14, mice in the DOX model groups were infected through an intramyocardial injection of either control shNC or shMettl14 (1 x 109 titer) at three distinct locations in the left ventricular free wall three times a week for 2 weeks, and they were treated daily with 30 mg/kg of ferroptosis inducer erastin (MedChemExpress, USA) through intragastric administration or vehicle control (Saline) for 2 weeks.

    Click to Show/Hide
Response regulation Doxorubicin treatment resulted in the upregulation of methyltransferase-like 14 (METTL14), which catalyzes the m6A modification of the long non-coding RNA KCNQ1OT1, a miR-7-5p sponge. And miR-7-5p inhibits DOX-induced ferroptosis in cardiomyocytes by directly repressing TFRC. Inhibiting ferroptosis mediated by a METTL14/KCNQ1OT1/miR-7-5p positive feedback loop in cardiomyocytes could provide a new therapeutic approach to control DOX-induced cardiac injury.
Experiment 2 Reporting the Ferroptosis-centered Disease Response [1]
Target Regulator hsa-miR-7-5p (miRNA) miRNA
Pathway Response Fatty acid metabolism hsa01212
Ferroptosis hsa04216
Cell Process Cell ferroptosis
In Vitro Model
AC16 [Human hybrid cardiomyocyte] cells Normal Homo sapiens CVCL_4U18
In Vivo Model
Male Sprague-Dawley rats (6-8 weeks old; weighed from 210 to 230 g) were purchased from HFK Bioscience Co. Ltd. Rats were randomly assigned to four groups (n = 6 per group). The first was the control group, which were treated daily with 0.5 ml of 0.9% saline by intraperitoneal injection for 14 days, and there were three DOX model groups, which were treated three times weekly with 2.5 mg/kg of DOX by intraperitoneal injection for 14 weeks. At day 14, mice in the DOX model groups were infected through an intramyocardial injection of either control shNC or shMettl14 (1 x 109 titer) at three distinct locations in the left ventricular free wall three times a week for 2 weeks, and they were treated daily with 30 mg/kg of ferroptosis inducer erastin (MedChemExpress, USA) through intragastric administration or vehicle control (Saline) for 2 weeks.

    Click to Show/Hide
Response regulation The RNA-binding protein IGF2BP1 is associated with KCNQ1OT1 to increase its stability and robustly inhibit miR-7-5p activity. MiR-7-5p could effectively suppress METLL14 and TFRC expression. The study suggested a therapeutic strategy to alleviate doxorubicin (DOX)-induced cardiomyopathy.
Cervical cancer [ICD-11: 2C77]
In total 1 item(s) under this disease
Experiment 1 Reporting the Ferroptosis-centered Disease Response [2]
Target Regulator hsa-miR-7-5p (miRNA) miRNA
Pathway Response Fatty acid metabolism hsa01212
Cell Process Cell ferroptosis
In Vitro Model
HeLa cells Endocervical adenocarcinoma Homo sapiens CVCL_0030
SAS cells Tongue squamous cell carcinoma Homo sapiens CVCL_1675
Response regulation Knockdown of miR-7-5p increased reactive oxygen species (ROS), mitochondrial membrane potential, and intracellular Fe2+amount. Furthermore, miR-7-5p knockdown results in the down-regulation of the iron storage gene expression such as ferritin, up-regulation of the ferroptosis marker ALOX12 gene expression, and increases of Liperfluo amount in Endocervical adenocarcinoma.
Retinopathy [ICD-11: 9B71]
In total 1 item(s) under this disease
Experiment 1 Reporting the Ferroptosis-centered Disease Response [3]
Target Regulator hsa-miR-7-5p (miRNA) miRNA
Pathway Response Ferroptosis hsa04216
Cell Process Cell ferroptosis
In Vitro Model
hRECs (Human retinal endothelial cells)
In Vivo Model
For in vivo experiments, the eyes in each group (n = 6) were enucleated carefully and processed for indirect immunofluorescence in whole-mount or cross-section as previously described. For cryosections, the eyes (n = 3 retinae from 3 mice) were fixed in 4% PFA at room temperature for 15 min. The frozen samples were then sliced transversely (6 um) at -20. For retinal flat-mounts, the eyes (n = 3 eyes from 3 mice) were fixed in 4% PFA at room temperature for 15 min, and the retinae were dissected out as cups. Both cryosections and retinal cups were blocked with PBS containing 0.5% Triton-X100 and 5% BSA at 4 overnight and included with the anti-CD31 and anti-GPX4 (1:100, ab125066, Abcam) primary antibodies.

    Click to Show/Hide
Response regulation ZFAS1 may act as a competing endogenous RNA by competitively binding with microRNA-7-5p (miR-7-5p) and modulating the expression of its downstream molecule acyl-CoA synthetase long-chain family member 4 (ACSL4), which is now identified as a classic driver gene of ferroptosis process. In conclusion, our results demonstrate that HG-induced ZFAS1 elevation activates ferroptosis in hRECs and the ZFAS1/ miR-7-5p/ACSL4 axis may serve as a therapeutic target for endothelial dysfunction in diabetic retinopathy.
Doxorubicin [Investigative]
In total 1 item(s) under this drug
Experiment 1 Reporting the Ferroptosis-centered Drug Response [1]
Drug for Ferroptosis Inducer
Response Target Transferrin receptor protein 1 (TFRC) Driver; Suppressor; Marker
Responsed Disease Cardiomyopathy ICD-11: BC43
Pathway Response Fatty acid metabolism hsa01212
Ferroptosis hsa04216
Cell Process Cell ferroptosis
Cell proliferation
In Vitro Model
AC16 [Human hybrid cardiomyocyte] cells Normal Homo sapiens CVCL_4U18
In Vivo Model
Male Sprague-Dawley rats (6-8 weeks old; weighed from 210 to 230 g) were purchased from HFK Bioscience Co. Ltd. Rats were randomly assigned to four groups (n = 6 per group). The first was the control group, which were treated daily with 0.5 ml of 0.9% saline by intraperitoneal injection for 14 days, and there were three DOX model groups, which were treated three times weekly with 2.5 mg/kg of DOX by intraperitoneal injection for 14 weeks. At day 14, mice in the DOX model groups were infected through an intramyocardial injection of either control shNC or shMettl14 (1 x 109 titer) at three distinct locations in the left ventricular free wall three times a week for 2 weeks, and they were treated daily with 30 mg/kg of ferroptosis inducer erastin (MedChemExpress, USA) through intragastric administration or vehicle control (Saline) for 2 weeks.

    Click to Show/Hide
Response regulation Doxorubicin treatment resulted in the upregulation of methyltransferase-like 14 (METTL14), which catalyzes the m6A modification of the long non-coding RNA KCNQ1OT1, a miR-7-5p sponge. And miR-7-5p inhibits DOX-induced ferroptosis in cardiomyocytes by directly repressing TFRC. Inhibiting ferroptosis mediated by a METTL14/KCNQ1OT1/miR-7-5p positive feedback loop in cardiomyocytes could provide a new therapeutic approach to control DOX-induced cardiac injury.
References
Ref 1 METTL14 promotes doxorubicin-induced cardiomyocyte ferroptosis by regulating the KCNQ1OT1-miR-7-5p-TFRC axis. Cell Biol Toxicol. 2023 Jun;39(3):1015-1035. doi: 10.1007/s10565-021-09660-7. Epub 2021 Oct 14.
Ref 2 MiR-7-5p Is Involved in Ferroptosis Signaling and Radioresistance Thru the Generation of ROS in Radioresistant HeLa and SAS Cell Lines. Int J Mol Sci. 2021 Aug 2;22(15):8300. doi: 10.3390/ijms22158300.
Ref 3 lncRNA ZFAS1 Positively Facilitates Endothelial Ferroptosis via miR-7-5p/ACSL4 Axis in Diabetic Retinopathy. Oxid Med Cell Longev. 2022 Aug 31;2022:9004738. doi: 10.1155/2022/9004738. eCollection 2022.