General Information of the Ferroptosis Regulator (ID: REG20003)
Regulator Name hsa-miR-19b-3p (miRNA)
Synonyms
hsa-miR-19b-3p
    Click to Show/Hide
Gene Name hsa-miR-19b-3p
Regulator Type miRNA
MiRBase ID MIMAT0000074
Sequence
UGUGCAAAUCCAUGCAAAACUGA

    Click to Show/Hide
Full List of the Ferroptosis Target of This Regulator and Corresponding Disease/Drug Response(s)
hsa-miR-19b-3p can regulate the following target(s), and cause disease/drug response(s). You can browse detail information of target(s) or disease/drug response(s).
Browse Target
Browse Disease
Browse Drug
Long-chain-fatty-acid--CoA ligase 4 (ACSL4) [Driver]
In total 2 item(s) under this target
Experiment 1 Reporting the Ferroptosis Target of This Regulator [1]
Target for Ferroptosis Driver
Responsed Disease Colorectal cancer ICD-11: 2B91
Responsed Drug Bromelain Investigative
Pathway Response Fatty acid metabolism hsa01212
Ferroptosis hsa04216
Cell Process Cell ferroptosis
Cell proliferation
In Vitro Model
NCI-H508 cells Cecum adenocarcinoma Homo sapiens CVCL_1564
HCT 116 cells Colon carcinoma Homo sapiens CVCL_0291
G13D (Human colorectal cancer cells)
DLD-1 cells Colon adenocarcinoma Homo sapiens CVCL_0248
G12D (Human colorectal cancer cells)
CCD-18Co cells Normal Homo sapiens CVCL_2379
In Vivo Model
Animals (n = 7) were given 2.5% DSS in drinking water for 5 days and then no treatment for 14 days as one cycle; this process was repeated for three cycles. In the last cycle, 2% DSS water treated to each group and no treatment for 14 days. During the three DSS cycle, 3 mg/kg bromelain were injected daily intraperitoneally and colon and spleen tissues were harvested after three DSS cycle in 57 days to study polyp burden and to perform histological staining.

    Click to Show/Hide
Response regulation Elevated miR-19b-3p, -130a-3p, -150-5p, -144-3p, -16-5p, -7a-5p, and -17-5p in bromelain-treated CaCO2cells compared to in DLD-1 cells potentially targeted ACSL-4 and resulted in suppression of ACSL-4. Overall, bromelain inhibits proliferation of Kras mutant Colorectal Cancer (CRC) effectively via ACSL-4.
Experiment 2 Reporting the Ferroptosis Target of This Regulator [4]
Target for Ferroptosis Driver
Responsed Disease Health ICD-11: N.A.
Pathway Response Fatty acid metabolism hsa01212
Ferroptosis hsa04216
Cell Process Cell ferroptosis
Cell proliferation
In Vitro Model
HUVECs (Human umbilical vein endothelial cells)
Response regulation The upregulated expression of individual miRNAs, miR-17, miR-18a, miR-19a, miR-20a, miR-19b and miR-92 were determined by qRT-PCR. This study revealed a novel mechanism through which miR-17-92 protects endothelial cells from erastin-induced ferroptosis by targeting the A20-ACSL4 axis.
Ferritin heavy chain (FTH1) [Suppressor; Marker]
In total 1 item(s) under this target
Experiment 1 Reporting the Ferroptosis Target of This Regulator [2]
Target for Ferroptosis Marker/Suppressor
Responsed Disease Lung cancer ICD-11: 2C25
Responsed Drug Curcumenol Investigative
Pathway Response Ferroptosis hsa04216
Cell Process Cell ferroptosis
Cell proliferation
In Vitro Model
NCI-H1299 cells Lung large cell carcinoma Homo sapiens CVCL_0060
NCI-H460 cells Lung large cell carcinoma Homo sapiens CVCL_0459
HEK-293T cells Normal Homo sapiens CVCL_0063
CCD-19Lu cells Normal Homo sapiens CVCL_2382
BEAS-2B cells Normal Homo sapiens CVCL_0168
In Vivo Model
A subcutaneous tumor-bearing nude mouse model was established by injecting the flank of BALB/c nude mice with 5 x 106 H460 cells. Ten days later, mice were blindly randomized into four groups and intravenously injected with 200 ul ddH2O containing 0.1% CMC-Na and 1% Tween 80, iron chelators DFO (100 mg/kg/day), curcumenol (200 mg/kg/day), and curcumenol combine DFO. Tumor long diameter, short diameter, and body weight were detected every two days after the first drug treatment. The tumor volume calculation formula: (tumor long diameter x tumor short diameter2)/2. Finally, mice were sacrificed. All tumors were collected for immunohistochemical (IHC) staining.

    Click to Show/Hide
Response regulation The natural product curcumenol exerted its antitumor effects on lung cancer by triggering ferroptosis, and the lncRNA H19/miR-19b-3p/FTH1 axis plays an essential role in curcumenol-induced ferroptotic cell death. Mechanistically, we showed that lncRNA H19 functioned as a competing endogenous RNA to bind to miR-19b-3p, thereby enhanced the transcription activity of its endogenous target, ferritin heavy chain 1 (FTH1), a marker of ferroptosis.
Phospholipid hydroperoxide glutathione peroxidase (GPX4) [Suppressor]
In total 1 item(s) under this target
Experiment 1 Reporting the Ferroptosis Target of This Regulator [3]
Target for Ferroptosis Suppressor
Responsed Disease Hepatocellular carcinoma ICD-11: 2C12
Pathway Response Ferroptosis hsa04216
Fatty acid metabolism hsa01212
Cell Process Cell ferroptosis
Cell proliferation
In Vitro Model
SMMC-7721 cells Endocervical adenocarcinoma Homo sapiens CVCL_0534
Huh-7 cells Hepatocellular carcinoma Homo sapiens CVCL_0336
Hep 3B2.1-7 cells Hepatocellular carcinoma Homo sapiens CVCL_0326
Hep-G2 cells Hepatoblastoma Homo sapiens CVCL_0027
L-02 cells Endocervical adenocarcinoma Homo sapiens CVCL_6926
In Vivo Model
C57BL/6 mice (4- to 6-week-old male) were fed in a pathogen-free vivarium under standard conditions at the animal care facility at Sun Yat-sen University. Hepa 1-6 cells transduced with RBMS1 or GPX4 or circIDE overexpression lentiviral vectors were subcutaneously injected into the right flank of mice in 100 ul of sterile PBS. IVIS images were taken.

    Click to Show/Hide
Response regulation RBMS1 overexpression inhibited hepatocellular Carcinoma (HCC) cell growth by attenuating the expression of glutathione peroxidase 4 (GPX4)and further facilitated ferroptosis in vitro and in vivo. More importantly, a novel circIDE (hsa_circ_0000251) was identified to elevate RBMS1 expression via sponging miR-19b-3p in HCC cells.
Colorectal cancer [ICD-11: 2B91]
In total 1 item(s) under this disease
Experiment 1 Reporting the Ferroptosis-centered Disease Response [1]
Target Regulator hsa-miR-19b-3p (miRNA) miRNA
Responsed Drug Bromelain Investigative
Pathway Response Fatty acid metabolism hsa01212
Ferroptosis hsa04216
Cell Process Cell ferroptosis
Cell proliferation
In Vitro Model
NCI-H508 cells Cecum adenocarcinoma Homo sapiens CVCL_1564
HCT 116 cells Colon carcinoma Homo sapiens CVCL_0291
G13D (Human colorectal cancer cells)
DLD-1 cells Colon adenocarcinoma Homo sapiens CVCL_0248
G12D (Human colorectal cancer cells)
CCD-18Co cells Normal Homo sapiens CVCL_2379
In Vivo Model
Animals (n = 7) were given 2.5% DSS in drinking water for 5 days and then no treatment for 14 days as one cycle; this process was repeated for three cycles. In the last cycle, 2% DSS water treated to each group and no treatment for 14 days. During the three DSS cycle, 3 mg/kg bromelain were injected daily intraperitoneally and colon and spleen tissues were harvested after three DSS cycle in 57 days to study polyp burden and to perform histological staining.

    Click to Show/Hide
Response regulation Elevated miR-19b-3p, -130a-3p, -150-5p, -144-3p, -16-5p, -7a-5p, and -17-5p in bromelain-treated CaCO2cells compared to in DLD-1 cells potentially targeted ACSL-4 and resulted in suppression of ACSL-4. Overall, bromelain inhibits proliferation of Kras mutant Colorectal Cancer (CRC) effectively via ACSL-4.
Lung cancer [ICD-11: 2C25]
In total 1 item(s) under this disease
Experiment 1 Reporting the Ferroptosis-centered Disease Response [2]
Target Regulator hsa-miR-19b-3p (miRNA) miRNA
Responsed Drug Curcumenol Investigative
Pathway Response Ferroptosis hsa04216
Cell Process Cell ferroptosis
Cell proliferation
In Vitro Model
NCI-H1299 cells Lung large cell carcinoma Homo sapiens CVCL_0060
NCI-H460 cells Lung large cell carcinoma Homo sapiens CVCL_0459
HEK-293T cells Normal Homo sapiens CVCL_0063
CCD-19Lu cells Normal Homo sapiens CVCL_2382
BEAS-2B cells Normal Homo sapiens CVCL_0168
In Vivo Model
A subcutaneous tumor-bearing nude mouse model was established by injecting the flank of BALB/c nude mice with 5 x 106 H460 cells. Ten days later, mice were blindly randomized into four groups and intravenously injected with 200 ul ddH2O containing 0.1% CMC-Na and 1% Tween 80, iron chelators DFO (100 mg/kg/day), curcumenol (200 mg/kg/day), and curcumenol combine DFO. Tumor long diameter, short diameter, and body weight were detected every two days after the first drug treatment. The tumor volume calculation formula: (tumor long diameter x tumor short diameter2)/2. Finally, mice were sacrificed. All tumors were collected for immunohistochemical (IHC) staining.

    Click to Show/Hide
Response regulation The natural product curcumenol exerted its antitumor effects on lung cancer by triggering ferroptosis, and the lncRNA H19/miR-19b-3p/FTH1 axis plays an essential role in curcumenol-induced ferroptotic cell death. Mechanistically, we showed that lncRNA H19 functioned as a competing endogenous RNA to bind to miR-19b-3p, thereby enhanced the transcription activity of its endogenous target, ferritin heavy chain 1 (FTH1), a marker of ferroptosis.
Hepatocellular carcinoma [ICD-11: 2C12]
In total 1 item(s) under this disease
Experiment 1 Reporting the Ferroptosis-centered Disease Response [3]
Target Regulator hsa-miR-19b-3p (miRNA) miRNA
Pathway Response Ferroptosis hsa04216
Fatty acid metabolism hsa01212
Cell Process Cell ferroptosis
Cell proliferation
In Vitro Model
SMMC-7721 cells Endocervical adenocarcinoma Homo sapiens CVCL_0534
Huh-7 cells Hepatocellular carcinoma Homo sapiens CVCL_0336
Hep 3B2.1-7 cells Hepatocellular carcinoma Homo sapiens CVCL_0326
Hep-G2 cells Hepatoblastoma Homo sapiens CVCL_0027
L-02 cells Endocervical adenocarcinoma Homo sapiens CVCL_6926
In Vivo Model
C57BL/6 mice (4- to 6-week-old male) were fed in a pathogen-free vivarium under standard conditions at the animal care facility at Sun Yat-sen University. Hepa 1-6 cells transduced with RBMS1 or GPX4 or circIDE overexpression lentiviral vectors were subcutaneously injected into the right flank of mice in 100 ul of sterile PBS. IVIS images were taken.

    Click to Show/Hide
Response regulation RBMS1 overexpression inhibited hepatocellular Carcinoma (HCC) cell growth by attenuating the expression of glutathione peroxidase 4 (GPX4)and further facilitated ferroptosis in vitro and in vivo. More importantly, a novel circIDE (hsa_circ_0000251) was identified to elevate RBMS1 expression via sponging miR-19b-3p in HCC cells.
Health [ICD-11: N.A.]
In total 1 item(s) under this disease
Experiment 1 Reporting the Ferroptosis-centered Disease Response [4]
Target Regulator hsa-miR-19b-3p (miRNA) miRNA
Pathway Response Fatty acid metabolism hsa01212
Ferroptosis hsa04216
Cell Process Cell ferroptosis
Cell proliferation
In Vitro Model
HUVECs (Human umbilical vein endothelial cells)
Response regulation The upregulated expression of individual miRNAs, miR-17, miR-18a, miR-19a, miR-20a, miR-19b and miR-92 were determined by qRT-PCR. This study revealed a novel mechanism through which miR-17-92 protects endothelial cells from erastin-induced ferroptosis by targeting the A20-ACSL4 axis.
Bromelain [Investigative]
In total 1 item(s) under this drug
Experiment 1 Reporting the Ferroptosis-centered Drug Response [1]
Drug for Ferroptosis Inducer
Response Target Long-chain-fatty-acid--CoA ligase 4 (ACSL4) Driver
Responsed Disease Colorectal cancer ICD-11: 2B91
Pathway Response Fatty acid metabolism hsa01212
Ferroptosis hsa04216
Cell Process Cell ferroptosis
Cell proliferation
In Vitro Model
NCI-H508 cells Cecum adenocarcinoma Homo sapiens CVCL_1564
HCT 116 cells Colon carcinoma Homo sapiens CVCL_0291
G13D (Human colorectal cancer cells)
DLD-1 cells Colon adenocarcinoma Homo sapiens CVCL_0248
G12D (Human colorectal cancer cells)
CCD-18Co cells Normal Homo sapiens CVCL_2379
In Vivo Model
Animals (n = 7) were given 2.5% DSS in drinking water for 5 days and then no treatment for 14 days as one cycle; this process was repeated for three cycles. In the last cycle, 2% DSS water treated to each group and no treatment for 14 days. During the three DSS cycle, 3 mg/kg bromelain were injected daily intraperitoneally and colon and spleen tissues were harvested after three DSS cycle in 57 days to study polyp burden and to perform histological staining.

    Click to Show/Hide
Response regulation Elevated miR-19b-3p, -130a-3p, -150-5p, -144-3p, -16-5p, -7a-5p, and -17-5p in bromelain-treated CaCO2cells compared to in DLD-1 cells potentially targeted ACSL-4 and resulted in suppression of ACSL-4. Overall, bromelain inhibits proliferation of Kras mutant Colorectal Cancer (CRC) effectively via ACSL-4.
Curcumenol [Investigative]
In total 1 item(s) under this drug
Experiment 1 Reporting the Ferroptosis-centered Drug Response [2]
Drug for Ferroptosis Inducer
Response Target Ferritin heavy chain (FTH1) Suppressor; Marker
Responsed Disease Lung cancer ICD-11: 2C25
Pathway Response Ferroptosis hsa04216
Cell Process Cell ferroptosis
Cell proliferation
In Vitro Model
NCI-H1299 cells Lung large cell carcinoma Homo sapiens CVCL_0060
NCI-H460 cells Lung large cell carcinoma Homo sapiens CVCL_0459
HEK-293T cells Normal Homo sapiens CVCL_0063
CCD-19Lu cells Normal Homo sapiens CVCL_2382
BEAS-2B cells Normal Homo sapiens CVCL_0168
In Vivo Model
A subcutaneous tumor-bearing nude mouse model was established by injecting the flank of BALB/c nude mice with 5 x 106 H460 cells. Ten days later, mice were blindly randomized into four groups and intravenously injected with 200 ul ddH2O containing 0.1% CMC-Na and 1% Tween 80, iron chelators DFO (100 mg/kg/day), curcumenol (200 mg/kg/day), and curcumenol combine DFO. Tumor long diameter, short diameter, and body weight were detected every two days after the first drug treatment. The tumor volume calculation formula: (tumor long diameter x tumor short diameter2)/2. Finally, mice were sacrificed. All tumors were collected for immunohistochemical (IHC) staining.

    Click to Show/Hide
Response regulation The natural product curcumenol exerted its antitumor effects on lung cancer by triggering ferroptosis, and the lncRNA H19/miR-19b-3p/FTH1 axis plays an essential role in curcumenol-induced ferroptotic cell death. Mechanistically, we showed that lncRNA H19 functioned as a competing endogenous RNA to bind to miR-19b-3p, thereby enhanced the transcription activity of its endogenous target, ferritin heavy chain 1 (FTH1), a marker of ferroptosis.
References
Ref 1 Bromelain effectively suppresses Kras-mutant colorectal cancer by stimulating ferroptosis. Anim Cells Syst (Seoul). 2018 Aug 30;22(5):334-340. doi: 10.1080/19768354.2018.1512521. eCollection 2018.
Ref 2 Curcumenol triggered ferroptosis in lung cancer cells via lncRNA H19/miR-19b-3p/FTH1 axis. Bioact Mater. 2021 Nov 19;13:23-36. doi: 10.1016/j.bioactmat.2021.11.013. eCollection 2022 Jul.
Ref 3 Suppressing circIDE/miR-19b-3p/RBMS1 axis exhibits promoting-tumour activity through upregulating GPX4 to diminish ferroptosis in hepatocellular carcinoma. Epigenetics. 2023 Dec;18(1):2192438. doi: 10.1080/15592294.2023.2192438.
Ref 4 miRNA-17-92 protects endothelial cells from erastin-induced ferroptosis through targeting the A20-ACSL4 axis. Biochem Biophys Res Commun. 2019 Jul 30;515(3):448-454. doi: 10.1016/j.bbrc.2019.05.147. Epub 2019 May 31.