Ferroptosis Regulator Information

General Information of the Ferroptosis Regulator (ID: REG20085)
Regulator Name hsa-miR-367-3p (miRNA)
Synonyms
hsa-miR-367-3p
    Click to Show/Hide
Gene Name hsa-miR-367-3p
Regulator Type miRNA
MiRBase ID MIMAT0000719
Sequence
AAUUGCACUUUAGCAAUGGUGA

    Click to Show/Hide
Full List of the Ferroptosis Target of This Regulator and Corresponding Disease/Drug Response(s)
hsa-miR-367-3p can regulate the following target(s), and cause disease/drug response(s). You can browse detail information of target(s) or disease/drug response(s).
Browse Target
Browse Disease
Transferrin receptor protein 1 (TFRC) [Driver; Suppressor; Marker]
 Target Info 
In total 1 item(s) under this target
Experiment 1 Reporting the Ferroptosis Target of This Regulator [1]
Target for Ferroptosis Marker/Suppressor/Driver
Responsed Disease Lung cancer ICD-11: 2C25
 Disease Info 
Pathway Response Fatty acid metabolism hsa01212
Ferroptosis hsa04216
Cell Process Cell ferroptosis
In Vitro Model
 A-549 cells Lung adenocarcinoma Homo sapiens CVCL_0023
SK-MES-1 cells Lung squamous cell carcinoma Homo sapiens CVCL_0630
HEK-293T cells Normal Homo sapiens CVCL_0063
Response regulation This study indicated that cinobufotalin induced ferroptosis to suppress lung cancer cell growth by lncRNA LINC00597/hsa-miR-367-3p/TFRC pathway via resibufogenin might provide novel therapeutic targets for lung cancer therapy.
Cystine/glutamate transporter (SLC7A11) [Driver; Suppressor]
 Target Info 
In total 1 item(s) under this target
Experiment 1 Reporting the Ferroptosis Target of This Regulator [2]
Target for Ferroptosis Suppressor
Responsed Disease Multiple sclerosis ICD-11: 8A40
 Disease Info 
Pathway Response Fatty acid metabolism hsa01212
Ferroptosis hsa04216
Cell Process Cell ferroptosis
In Vitro Model
 hBMSCs (Bone marrow stromal cells)
BV-2 cells Normal Mus musculus CVCL_0182
In Vivo Model
Female C57BL6 mice were randomized into four groups (n = 8/group): the control group (non-EAE mice), the EAE group (EAE mice injected intrathecally with 5 uL PBS when symptoms appeared), the EAE + BMSCs-Exo + mimic negative control (NC) group (EAE mice injected intrathecally with Exos from bone MSCs (BMSCs) transfected with mimic NC [5 uL, 2 ug/L in PBS] when symptoms appeared), and the EAE + BMSCs-Exo + miR-367-3p mimic group (EAE mice injected intrathecally with Exos from BMSCs transfected with miR-367-3p mimic [5 uL, 2 ug/L in PBS] when symptoms appeared).

    Click to Show/Hide
Response regulation MiR-367-3p can be delivered by BMSC-Exos into microglia, where miR-367-3p inhibits EZH2 expression and activates the expression of SLC7A11, suppressing microglial ferroptosis and relieving the symptoms of EAE. Experimental autoimmune encephalomyelitis (EAE) is a typical animal model of multiple sclerosis.
Lung cancer [ICD-11: 2C25]
 Disease Info 
In total 1 item(s) under this disease
Experiment 1 Reporting the Ferroptosis-centered Disease Response [1]
Target Regulator hsa-miR-367-3p (miRNA) miRNA
 Regulator Info 
Pathway Response Fatty acid metabolism hsa01212
Ferroptosis hsa04216
Cell Process Cell ferroptosis
In Vitro Model
 A-549 cells Lung adenocarcinoma Homo sapiens CVCL_0023
SK-MES-1 cells Lung squamous cell carcinoma Homo sapiens CVCL_0630
HEK-293T cells Normal Homo sapiens CVCL_0063
Response regulation This study indicated that cinobufotalin induced ferroptosis to suppress lung cancer cell growth by lncRNA LINC00597/hsa-miR-367-3p/TFRC pathway via resibufogenin might provide novel therapeutic targets for lung cancer therapy.
Multiple sclerosis [ICD-11: 8A40]
 Disease Info 
In total 1 item(s) under this disease
Experiment 1 Reporting the Ferroptosis-centered Disease Response [2]
Target Regulator hsa-miR-367-3p (miRNA) miRNA
 Regulator Info 
Pathway Response Fatty acid metabolism hsa01212
Ferroptosis hsa04216
Cell Process Cell ferroptosis
In Vitro Model
 hBMSCs (Bone marrow stromal cells)
BV-2 cells Normal Mus musculus CVCL_0182
In Vivo Model
Female C57BL6 mice were randomized into four groups (n = 8/group): the control group (non-EAE mice), the EAE group (EAE mice injected intrathecally with 5 uL PBS when symptoms appeared), the EAE + BMSCs-Exo + mimic negative control (NC) group (EAE mice injected intrathecally with Exos from bone MSCs (BMSCs) transfected with mimic NC [5 uL, 2 ug/L in PBS] when symptoms appeared), and the EAE + BMSCs-Exo + miR-367-3p mimic group (EAE mice injected intrathecally with Exos from BMSCs transfected with miR-367-3p mimic [5 uL, 2 ug/L in PBS] when symptoms appeared).

    Click to Show/Hide
Response regulation MiR-367-3p can be delivered by BMSC-Exos into microglia, where miR-367-3p inhibits EZH2 expression and activates the expression of SLC7A11, suppressing microglial ferroptosis and relieving the symptoms of EAE. Experimental autoimmune encephalomyelitis (EAE) is a typical animal model of multiple sclerosis.
References
Ref 1 Cinobufotalin Induces Ferroptosis to Suppress Lung Cancer Cell Growth by lncRNA LINC00597/hsa-miR-367-3p/TFRC Pathway via Resibufogenin. Anticancer Agents Med Chem. 2023;23(6):717-725. doi: 10.2174/1871520622666221010092922.
Ref 2 Mesenchymal stem cell-derived exosomal microRNA-367-3p alleviates experimental autoimmune encephalomyelitis via inhibition of microglial ferroptosis by targeting EZH2. Biomed Pharmacother. 2023 Jun;162:114593. doi: 10.1016/j.biopha.2023.114593. Epub 2023 Mar 29.