General Information of the Ferroptosis Regulator (ID: REG20015)
Regulator Name hsa-miR-10a-5p (miRNA)
Synonyms
hsa-miR-10a-5p
    Click to Show/Hide
Gene Name hsa-miR-10a-5p
Regulator Type miRNA
MiRBase ID MIMAT0000253
Sequence
UACCCUGUAGAUCCGAAUUUGUG

    Click to Show/Hide
Full List of the Ferroptosis Target of This Regulator and Corresponding Disease/Drug Response(s)
hsa-miR-10a-5p can regulate the following target(s), and cause disease/drug response(s). You can browse detail information of target(s) or disease/drug response(s).
Browse Target
Browse Disease
Solute carrier family 40 member 1 (SLC40A1) [Suppressor; Marker]
In total 1 item(s) under this target
Experiment 1 Reporting the Ferroptosis Target of This Regulator [1]
Target for Ferroptosis Marker/Suppressor
Responsed Disease Intervertebral disc degeneration ICD-11: FA80
Pathway Response Fatty acid metabolism hsa01212
Ferroptosis hsa04216
Cell Process Cell ferroptosis
In Vitro Model
hCDs (Chondrocytes)
Response regulation Inflammatory cytokine IL-6 appeared in Intervertebral disc degeneration (IDD) aggravates its degeneration by inducing cartilage cell ferroptosis. This is caused partially by inhibiting miR-10a-5p and subsequently derepressing IL-6R signaling pathway. The ferroptosis-inhibitory effect exhibited by overexpressing miR-10a-5p was achieved by promoting GPX4 and ferroportin-1 (FPN1) but suppressing divalent metal transporter 1 (DMT1) expression in IL-6-treated cartilage cells.
Phospholipid hydroperoxide glutathione peroxidase (GPX4) [Suppressor]
In total 1 item(s) under this target
Experiment 1 Reporting the Ferroptosis Target of This Regulator [1]
Target for Ferroptosis Suppressor
Responsed Disease Intervertebral disc degeneration ICD-11: FA80
Pathway Response Fatty acid metabolism hsa01212
Ferroptosis hsa04216
Cell Process Cell ferroptosis
In Vitro Model
hCDs (Chondrocytes)
Response regulation Inflammatory cytokine IL-6 appeared in Intervertebral disc degeneration (IDD) aggravates its degeneration by inducing cartilage cell ferroptosis. This is caused partially by inhibiting miR-10a-5p and subsequently derepressing IL-6R signaling pathway. The ferroptosis-inhibitory effect exhibited by overexpressing miR-10a-5p was achieved by promoting GPX4 and ferroportin-1 (FPN1) but suppressing divalent metal transporter 1 (DMT1) expression in IL-6-treated cartilage cells.
Natural resistance-associated macrophage protein 2 (SLC11A2) [Driver]
In total 1 item(s) under this target
Experiment 1 Reporting the Ferroptosis Target of This Regulator [1]
Target for Ferroptosis Driver
Responsed Disease Intervertebral disc degeneration ICD-11: FA80
Pathway Response Fatty acid metabolism hsa01212
Ferroptosis hsa04216
Cell Process Cell ferroptosis
In Vitro Model
hCDs (Chondrocytes)
Response regulation Inflammatory cytokine IL-6 appeared in Intervertebral disc degeneration (IDD) aggravates its degeneration by inducing cartilage cell ferroptosis. This is caused partially by inhibiting miR-10a-5p and subsequently derepressing IL-6R signaling pathway. The ferroptosis-inhibitory effect exhibited by overexpressing miR-10a-5p was achieved by promoting GPX4 and ferroportin-1 (FPN1) but suppressing divalent metal transporter 1 (DMT1) expression in IL-6-treated cartilage cells.
Intervertebral disc degeneration [ICD-11: FA80]
In total 3 item(s) under this disease
Experiment 1 Reporting the Ferroptosis-centered Disease Response [1]
Target Regulator hsa-miR-10a-5p (miRNA) miRNA
Pathway Response Fatty acid metabolism hsa01212
Ferroptosis hsa04216
Cell Process Cell ferroptosis
In Vitro Model
hCDs (Chondrocytes)
Response regulation Inflammatory cytokine IL-6 appeared in Intervertebral disc degeneration (IDD) aggravates its degeneration by inducing cartilage cell ferroptosis. This is caused partially by inhibiting miR-10a-5p and subsequently derepressing IL-6R signaling pathway. The ferroptosis-inhibitory effect exhibited by overexpressing miR-10a-5p was achieved by promoting GPX4 and ferroportin-1 (FPN1) but suppressing divalent metal transporter 1 (DMT1) expression in IL-6-treated cartilage cells.
Experiment 2 Reporting the Ferroptosis-centered Disease Response [1]
Target Regulator hsa-miR-10a-5p (miRNA) miRNA
Pathway Response Fatty acid metabolism hsa01212
Ferroptosis hsa04216
Cell Process Cell ferroptosis
In Vitro Model
hCDs (Chondrocytes)
Response regulation Inflammatory cytokine IL-6 appeared in Intervertebral disc degeneration (IDD) aggravates its degeneration by inducing cartilage cell ferroptosis. This is caused partially by inhibiting miR-10a-5p and subsequently derepressing IL-6R signaling pathway. The ferroptosis-inhibitory effect exhibited by overexpressing miR-10a-5p was achieved by promoting GPX4 and ferroportin-1 (FPN1) but suppressing divalent metal transporter 1 (DMT1) expression in IL-6-treated cartilage cells.
Experiment 3 Reporting the Ferroptosis-centered Disease Response [1]
Target Regulator hsa-miR-10a-5p (miRNA) miRNA
Pathway Response Fatty acid metabolism hsa01212
Ferroptosis hsa04216
Cell Process Cell ferroptosis
In Vitro Model
hCDs (Chondrocytes)
Response regulation Inflammatory cytokine IL-6 appeared in Intervertebral disc degeneration (IDD) aggravates its degeneration by inducing cartilage cell ferroptosis. This is caused partially by inhibiting miR-10a-5p and subsequently derepressing IL-6R signaling pathway. The ferroptosis-inhibitory effect exhibited by overexpressing miR-10a-5p was achieved by promoting GPX4 and ferroportin-1 (FPN1) but suppressing divalent metal transporter 1 (DMT1) expression in IL-6-treated cartilage cells.
References
Ref 1 Targeting miR-10a-5p/IL-6R axis for reducing IL-6-induced cartilage cell ferroptosis. Exp Mol Pathol. 2021 Feb;118:104570. doi: 10.1016/j.yexmp.2020.104570. Epub 2020 Nov 7.