General Information of the Ferroptosis Regulator (ID: REG20005)
Regulator Name hsa-miR-27a-3p (miRNA)
Synonyms
hsa-miR-27a-3p
    Click to Show/Hide
Gene Name hsa-miR-27a-3p
Regulator Type miRNA
MiRBase ID MIMAT0000084
Sequence
UUCACAGUGGCUAAGUUCCGC

    Click to Show/Hide
Full List of the Ferroptosis Target of This Regulator and Corresponding Disease/Drug Response(s)
hsa-miR-27a-3p can regulate the following target(s), and cause disease/drug response(s). You can browse detail information of target(s) or disease/drug response(s).
Browse Target
Browse Disease
Phospholipid hydroperoxide glutathione peroxidase (GPX4) [Suppressor]
In total 1 item(s) under this target
Experiment 1 Reporting the Ferroptosis Target of This Regulator [1]
Target for Ferroptosis Suppressor
Responsed Disease Oesophageal cancer ICD-11: 2B70
Pathway Response Fatty acid metabolism hsa01212
Cell Process Cell ferroptosis
Cell proliferation
Cell migration
Cell invasion
In Vitro Model
Eca-109 cells Esophageal squamous cell carcinoma Homo sapiens CVCL_6898
In Vivo Model
Nude mice of both sexes (age: 6-8 weeks, weight: 22-25 g) were purchased from HUNAN SJA LABRATORY ANIMAL CO., LTD (Hunan, China). The EC109 cells stably expressing sh-circBCAR3 or sh-nc were established by infection with corresponding lentivirus vectors. 1 x 106 mL-1 (100 uL) cells were subcutaneously inoculated into the nude mice. The tumor volumes had been measured from day 5 to day 25. On day 25, the xenograft tumors were removed surgically, and the tumor weight was detected.

    Click to Show/Hide
Response regulation CircBCAR3 binds with miR-27a-3p to promote TNPO1 expression. GPX4 protein levels were increased by silencing of circBCAR3. And circBCAR3 promoted the proliferation, migration, invasion, and ferroptosis of esophageal cancer cells by miR-27a-3p.
Nuclear factor erythroid 2-related factor 2 (NFE2L2) [Suppressor; Marker]
In total 1 item(s) under this target
Experiment 1 Reporting the Ferroptosis Target of This Regulator [2]
Target for Ferroptosis Marker/Suppressor
Responsed Disease Cerebral ischaemic stroke ICD-11: 8B11
Pathway Response Ferroptosis hsa04216
Cell Process Cell ferroptosis
In Vitro Model
hBCs (Brain cells)
In Vivo Model
SPF male Sprague Dawley rats aged 8 weeks were purchased from Beijing HFK Bioscience Co., Ltd. and housed in the Experimental Animal Center of North China University of Science and Technology (licence no. SYXK(Ji)2020-007) at 22 ± 2 with 60 ± 5% humidity, 12 h light/dark cycles, and free access to food and water. The rats were raised adaptively for approximately 7 days before experimental manipulation. The animals were handled according to the National Institute of Healths Guide for the Care and Use of Laboratory Animals (1996) guidelines, and all animal experiments were approved by the Animal Care and Use Committee of North China University of Science and Technology. In addition, all efforts were made to minimize the number of animals used and their suffering.

    Click to Show/Hide
Response regulation miRNA-27-a inhibited Nrf2 in a targeted manner, which also exacerbated the extent of ferroptosis. Therefore, the present study indicated that miRNA-27-a may aggravate brain tissue ferroptosis during ischaemic stroke, potentially by inhibiting Nrf2.
Cystine/glutamate transporter (SLC7A11) [Driver; Suppressor]
In total 2 item(s) under this target
Experiment 1 Reporting the Ferroptosis Target of This Regulator [3]
Target for Ferroptosis Driver
Responsed Disease Lung cancer ICD-11: 2C25
Pathway Response Fatty acid metabolism hsa01212
Ferroptosis hsa04216
Cell Process Cell ferroptosis
Cell proliferation
In Vitro Model
BEAS-2B cells Normal Homo sapiens CVCL_0168
A-549 cells Lung adenocarcinoma Homo sapiens CVCL_0023
Response regulation MiR-27a-3p, was an essential modulator of ferroptosisviadirectly targeting SLC7A11 in non-small cell lung cancer cells. Overexpressing miR-27a-3p led to SLC7A11 suppressionviadirectly binding to its 3'-UTR, followed by the reduction of erastin-caused ferroptosis.
Experiment 2 Reporting the Ferroptosis Target of This Regulator [4]
Target for Ferroptosis Suppressor
Responsed Disease Ischemia/reperfusion injury ICD-11: DB98
Pathway Response Ferroptosis hsa04216
Fatty acid metabolism hsa01212
Cell Process Cell ferroptosis
In Vitro Model
hBCs (Brain cells)
In Vivo Model
The rats were anesthetized by intraperitoneal injection of pentobarbital sodium (40 mg/kg). Before the experiment, the rats were fasted for 8-10 h and ensured sufficient water. The left common carotid artery (CCA) and left external carotid artery (ECA) were ligated after skin incision in the middle of the neck. In the common carotid artery cut a small incision. In order to induce ischemia, a cord plug was inserted through the incision into the internal carotid artery (ICA) and then to the origin of the middle cerebral artery (MCA). After ischemia for 2 h, the rats were anesthetized and gently pulled out the cord plug. At the end of the reperfusion time, the rats were euthanized by injection of a minimal lethal dose of anesthesia.

    Click to Show/Hide
Response regulation The results of dual luciferase reporter gene technique indicated SLC7A11 as the target gene of miR-27a. In the current study, miR-27a upregulates ferroptosis to aggravate cerebral ischemia-reperfusion injury by SLC7A11.
Unspecific Target [Unspecific Target]
In total 1 item(s) under this target
Experiment 1 Reporting the Ferroptosis Target of This Regulator [5]
Responsed Disease Glioblastoma ICD-11: 2A00
Pathway Response Fatty acid metabolism hsa01212
Ferroptosis hsa04216
Apoptosis hsa04210
Cell Process Cell ferroptosis
Cell apoptosis
Cell proliferation
Cell migration
Cell invasion
In Vitro Model
U87 MG-Red-Fluc cells Glioblastoma Homo sapiens CVCL_5J12
U-251MG cells Astrocytoma Homo sapiens CVCL_0021
In Vivo Model
In this study, 4-week-old specific pathogen free male nude mice were selected and assigned into 4 groups, each of which was respectively injected with U251 cells and U87 cells transfected with NC, hsa-miR-27a-3p angomir, si-TMEM161B-AS1, si-TMEM161B-AS1 + hsa-miR-27a-3p angomir. Each nude mouse was subcutaneously injected with 4 x 105 cells in the right flank area for subcutaneous implantation.

    Click to Show/Hide
Response regulation Knockdown of TMEM161B-AS1 down-regulated the expression of FANCD2 and CD44 by sponging hsa-miR-27a-3p, inhibited the proliferation, migration, invasion and promoted apoptosis, ferroptosis of U87 cells and U251 cells. These findings were expected to provide promising therapeutic targets for the treatment of glioma.
Oesophageal cancer [ICD-11: 2B70]
In total 1 item(s) under this disease
Experiment 1 Reporting the Ferroptosis-centered Disease Response [1]
Target Regulator hsa-miR-27a-3p (miRNA) miRNA
Pathway Response Fatty acid metabolism hsa01212
Cell Process Cell ferroptosis
Cell proliferation
Cell migration
Cell invasion
In Vitro Model
Eca-109 cells Esophageal squamous cell carcinoma Homo sapiens CVCL_6898
In Vivo Model
Nude mice of both sexes (age: 6-8 weeks, weight: 22-25 g) were purchased from HUNAN SJA LABRATORY ANIMAL CO., LTD (Hunan, China). The EC109 cells stably expressing sh-circBCAR3 or sh-nc were established by infection with corresponding lentivirus vectors. 1 x 106 mL-1 (100 uL) cells were subcutaneously inoculated into the nude mice. The tumor volumes had been measured from day 5 to day 25. On day 25, the xenograft tumors were removed surgically, and the tumor weight was detected.

    Click to Show/Hide
Response regulation CircBCAR3 binds with miR-27a-3p to promote TNPO1 expression. GPX4 protein levels were increased by silencing of circBCAR3. And circBCAR3 promoted the proliferation, migration, invasion, and ferroptosis of esophageal cancer cells by miR-27a-3p.
Lung cancer [ICD-11: 2C25]
In total 1 item(s) under this disease
Experiment 1 Reporting the Ferroptosis-centered Disease Response [3]
Target Regulator hsa-miR-27a-3p (miRNA) miRNA
Pathway Response Fatty acid metabolism hsa01212
Ferroptosis hsa04216
Cell Process Cell ferroptosis
Cell proliferation
In Vitro Model
BEAS-2B cells Normal Homo sapiens CVCL_0168
A-549 cells Lung adenocarcinoma Homo sapiens CVCL_0023
Response regulation MiR-27a-3p, was an essential modulator of ferroptosisviadirectly targeting SLC7A11 in non-small cell lung cancer cells. Overexpressing miR-27a-3p led to SLC7A11 suppressionviadirectly binding to its 3'-UTR, followed by the reduction of erastin-caused ferroptosis.
Cerebral ischaemic stroke [ICD-11: 8B11]
In total 1 item(s) under this disease
Experiment 1 Reporting the Ferroptosis-centered Disease Response [2]
Target Regulator hsa-miR-27a-3p (miRNA) miRNA
Pathway Response Ferroptosis hsa04216
Cell Process Cell ferroptosis
In Vitro Model
hBCs (Brain cells)
In Vivo Model
SPF male Sprague Dawley rats aged 8 weeks were purchased from Beijing HFK Bioscience Co., Ltd. and housed in the Experimental Animal Center of North China University of Science and Technology (licence no. SYXK(Ji)2020-007) at 22 ± 2 with 60 ± 5% humidity, 12 h light/dark cycles, and free access to food and water. The rats were raised adaptively for approximately 7 days before experimental manipulation. The animals were handled according to the National Institute of Healths Guide for the Care and Use of Laboratory Animals (1996) guidelines, and all animal experiments were approved by the Animal Care and Use Committee of North China University of Science and Technology. In addition, all efforts were made to minimize the number of animals used and their suffering.

    Click to Show/Hide
Response regulation miRNA-27-a inhibited Nrf2 in a targeted manner, which also exacerbated the extent of ferroptosis. Therefore, the present study indicated that miRNA-27-a may aggravate brain tissue ferroptosis during ischaemic stroke, potentially by inhibiting Nrf2.
Ischemia/reperfusion injury [ICD-11: DB98]
In total 1 item(s) under this disease
Experiment 1 Reporting the Ferroptosis-centered Disease Response [4]
Target Regulator hsa-miR-27a-3p (miRNA) miRNA
Pathway Response Ferroptosis hsa04216
Fatty acid metabolism hsa01212
Cell Process Cell ferroptosis
In Vitro Model
hBCs (Brain cells)
In Vivo Model
The rats were anesthetized by intraperitoneal injection of pentobarbital sodium (40 mg/kg). Before the experiment, the rats were fasted for 8-10 h and ensured sufficient water. The left common carotid artery (CCA) and left external carotid artery (ECA) were ligated after skin incision in the middle of the neck. In the common carotid artery cut a small incision. In order to induce ischemia, a cord plug was inserted through the incision into the internal carotid artery (ICA) and then to the origin of the middle cerebral artery (MCA). After ischemia for 2 h, the rats were anesthetized and gently pulled out the cord plug. At the end of the reperfusion time, the rats were euthanized by injection of a minimal lethal dose of anesthesia.

    Click to Show/Hide
Response regulation The results of dual luciferase reporter gene technique indicated SLC7A11 as the target gene of miR-27a. In the current study, miR-27a upregulates ferroptosis to aggravate cerebral ischemia-reperfusion injury by SLC7A11.
Glioblastoma [ICD-11: 2A00]
In total 1 item(s) under this disease
Experiment 1 Reporting the Ferroptosis-centered Disease Response [5]
Target Regulator hsa-miR-27a-3p (miRNA) miRNA
Pathway Response Fatty acid metabolism hsa01212
Ferroptosis hsa04216
Apoptosis hsa04210
Cell Process Cell ferroptosis
Cell apoptosis
Cell proliferation
Cell migration
Cell invasion
In Vitro Model
U87 MG-Red-Fluc cells Glioblastoma Homo sapiens CVCL_5J12
U-251MG cells Astrocytoma Homo sapiens CVCL_0021
In Vivo Model
In this study, 4-week-old specific pathogen free male nude mice were selected and assigned into 4 groups, each of which was respectively injected with U251 cells and U87 cells transfected with NC, hsa-miR-27a-3p angomir, si-TMEM161B-AS1, si-TMEM161B-AS1 + hsa-miR-27a-3p angomir. Each nude mouse was subcutaneously injected with 4 x 105 cells in the right flank area for subcutaneous implantation.

    Click to Show/Hide
Response regulation Knockdown of TMEM161B-AS1 down-regulated the expression of FANCD2 and CD44 by sponging hsa-miR-27a-3p, inhibited the proliferation, migration, invasion and promoted apoptosis, ferroptosis of U87 cells and U251 cells. These findings were expected to provide promising therapeutic targets for the treatment of glioma.
References
Ref 1 CircBCAR3 accelerates esophageal cancer tumorigenesis and metastasis via sponging miR-27a-3p. Mol Cancer. 2022 Jul 15;21(1):145. doi: 10.1186/s12943-022-01615-8.
Ref 2 Micro Ribonucleic Acid 27a Aggravates Ferroptosis During Early Ischemic Stroke of Rats Through Nuclear Factor Erythroid-2-Related Factor 2. Neuroscience. 2022 Nov 10;504:10-20. doi: 10.1016/j.neuroscience.2022.09.014. Epub 2022 Sep 27.
Ref 3 MiR-27a-3p Promotes Non-Small Cell Lung Cancer Through SLC7A11-Mediated-Ferroptosis. Front Oncol. 2021 Oct 13;11:759346. doi: 10.3389/fonc.2021.759346. eCollection 2021.
Ref 4 MicroRNA-27a Regulates Ferroptosis Through SLC7A11 to Aggravate Cerebral ischemia-reperfusion Injury. Neurochem Res. 2023 May;48(5):1370-1381. doi: 10.1007/s11064-022-03826-3. Epub 2022 Dec 2.
Ref 5 Over-expression of lncRNA TMEM161B-AS1 promotes the malignant biological behavior of glioma cells and the resistance to temozolomide via up-regulating the expression of multiple ferroptosis-related genes by sponging hsa-miR-27a-3p. Cell Death Discov. 2021 Oct 23;7(1):311. doi: 10.1038/s41420-021-00709-4.