Ferroptosis Regulator Information

General Information of the Ferroptosis Regulator (ID: REG20004)
Regulator Name hsa-miR-23a-3p (miRNA)
Synonyms
hsa-miR-23a-3p
    Click to Show/Hide
Gene Name hsa-miR-23a-3p
Regulator Type miRNA
MiRBase ID MIMAT0000078
Sequence
AUCACAUUGCCAGGGAUUUCC

    Click to Show/Hide
Full List of the Ferroptosis Target of This Regulator and Corresponding Disease/Drug Response(s)
hsa-miR-23a-3p can regulate the following target(s), and cause disease/drug response(s). You can browse detail information of target(s) or disease/drug response(s).
Browse Target
Browse Disease
Browse Drug
Long-chain-fatty-acid--CoA ligase 4 (ACSL4) [Driver]
 Target Info 
In total 1 item(s) under this target
Experiment 1 Reporting the Ferroptosis Target of This Regulator [1]
Target for Ferroptosis Driver
Responsed Disease Hepatocellular carcinoma ICD-11: 2C12
 Disease Info 
Responsed Drug Sorafenib Investigative
 Drug Info 
Pathway Response Fatty acid metabolism hsa01212
Ferroptosis hsa04216
Cell Process Cell ferroptosis
In Vitro Model
 MHCC97-L cells Hepatocellular carcinoma Homo sapiens CVCL_4973
PLC/PRF/5 cells Hepatocellular carcinoma Homo sapiens CVCL_0485
HEK293 FT cells Normal Homo sapiens CVCL_6911
In Vivo Model
Parental MHCC97L cells (2 x 106 cells/mouse) were subcutaneously injected into the 4-to-5-week-old NOD-SCID mice. When the tumours reached a volume of around 50-100 mm3 (calculated by the formula 4/3(D/2)(d/2)2, where D and d represent the minor and major axis of the tumour, respectively), the maximum tolerated dose of sorafenib (50 mg/kg) was given to the mice by oral gavage daily until the drug resistance occurred, denoted as the drug resistant group. For the control, the wild type group was treated with the vehicle (0.5% CMC-Na). The tumour size and body weight were measured every 3 days.

    Click to Show/Hide
Response regulation Sorafenib treatment triggered ferroptosis via lipid ROS production and chelatable iron accumulation. The ETS1 upregulated by sorafenib was a key transcription factor of miR-23a-3p that directly enhanced miR-23a-3p expression. MiR-23a-3p recognized and bound to ACSL4 3UTR to limit lipid ROS production, thus attenuating sorafenib-induced ferroptotic cell death in hepatocellular carcinoma.
Natural resistance-associated macrophage protein 2 (SLC11A2) [Driver]
 Target Info 
In total 1 item(s) under this target
Experiment 1 Reporting the Ferroptosis Target of This Regulator [2]
Target for Ferroptosis Driver
Responsed Disease Acute myocardial infarction ICD-11: BA41
 Disease Info 
Pathway Response Fatty acid metabolism hsa01212
Ferroptosis hsa04216
Cell Process Cell ferroptosis
In Vitro Model
 hUCB-MSCs (Human umbilical cord blood derived mesenchymal stem cells)
In Vivo Model
A total of 72 C57BL/6J mice (six animals per group) were obtained from the Shanghai Laboratory Animals Center. The mouse model of AMI was performed by permanent ligation of the LAD coronary artery. PBS or exosomes (5 ug, in 20 ul PBS) was injected into the border zone of infarcted heart at three sites.

    Click to Show/Hide
Response regulation The exosome of MSCs derived from human umbilical cord blood (HUCB-MSC) has been reported to have cardioprotective effects on mouse models of acute myocardial infarction (AMI) and cardiomyocyte hypoxia injury. HUCB-MSCs-exosomes may suppress DMT1 expression by miR-23a-3p to inhibit ferroptosis and attenuate myocardial injury.
Hepatocellular carcinoma [ICD-11: 2C12]
 Disease Info 
In total 1 item(s) under this disease
Experiment 1 Reporting the Ferroptosis-centered Disease Response [1]
Target Regulator hsa-miR-23a-3p (miRNA) miRNA
 Regulator Info 
Responsed Drug Sorafenib Investigative
 Drug Info 
Pathway Response Fatty acid metabolism hsa01212
Ferroptosis hsa04216
Cell Process Cell ferroptosis
In Vitro Model
 MHCC97-L cells Hepatocellular carcinoma Homo sapiens CVCL_4973
PLC/PRF/5 cells Hepatocellular carcinoma Homo sapiens CVCL_0485
HEK293 FT cells Normal Homo sapiens CVCL_6911
In Vivo Model
Parental MHCC97L cells (2 x 106 cells/mouse) were subcutaneously injected into the 4-to-5-week-old NOD-SCID mice. When the tumours reached a volume of around 50-100 mm3 (calculated by the formula 4/3(D/2)(d/2)2, where D and d represent the minor and major axis of the tumour, respectively), the maximum tolerated dose of sorafenib (50 mg/kg) was given to the mice by oral gavage daily until the drug resistance occurred, denoted as the drug resistant group. For the control, the wild type group was treated with the vehicle (0.5% CMC-Na). The tumour size and body weight were measured every 3 days.

    Click to Show/Hide
Response regulation Sorafenib treatment triggered ferroptosis via lipid ROS production and chelatable iron accumulation. The ETS1 upregulated by sorafenib was a key transcription factor of miR-23a-3p that directly enhanced miR-23a-3p expression. MiR-23a-3p recognized and bound to ACSL4 3UTR to limit lipid ROS production, thus attenuating sorafenib-induced ferroptotic cell death in hepatocellular carcinoma.
Acute myocardial infarction [ICD-11: BA41]
 Disease Info 
In total 1 item(s) under this disease
Experiment 1 Reporting the Ferroptosis-centered Disease Response [2]
Target Regulator hsa-miR-23a-3p (miRNA) miRNA
 Regulator Info 
Pathway Response Fatty acid metabolism hsa01212
Ferroptosis hsa04216
Cell Process Cell ferroptosis
In Vitro Model
 hUCB-MSCs (Human umbilical cord blood derived mesenchymal stem cells)
In Vivo Model
A total of 72 C57BL/6J mice (six animals per group) were obtained from the Shanghai Laboratory Animals Center. The mouse model of AMI was performed by permanent ligation of the LAD coronary artery. PBS or exosomes (5 ug, in 20 ul PBS) was injected into the border zone of infarcted heart at three sites.

    Click to Show/Hide
Response regulation The exosome of MSCs derived from human umbilical cord blood (HUCB-MSC) has been reported to have cardioprotective effects on mouse models of acute myocardial infarction (AMI) and cardiomyocyte hypoxia injury. HUCB-MSCs-exosomes may suppress DMT1 expression by miR-23a-3p to inhibit ferroptosis and attenuate myocardial injury.
Sorafenib [Investigative]
 Drug Info 
In total 1 item(s) under this drug
Experiment 1 Reporting the Ferroptosis-centered Drug Response [1]
Drug for Ferroptosis Suppressor
Response Target Long-chain-fatty-acid--CoA ligase 4 (ACSL4) Driver
 Target Info 
Responsed Disease Hepatocellular carcinoma ICD-11: 2C12
 Disease Info 
Pathway Response Fatty acid metabolism hsa01212
Ferroptosis hsa04216
Cell Process Cell ferroptosis
In Vitro Model
 MHCC97-L cells Hepatocellular carcinoma Homo sapiens CVCL_4973
PLC/PRF/5 cells Hepatocellular carcinoma Homo sapiens CVCL_0485
HEK293 FT cells Normal Homo sapiens CVCL_6911
In Vivo Model
Parental MHCC97L cells (2 x 106 cells/mouse) were subcutaneously injected into the 4-to-5-week-old NOD-SCID mice. When the tumours reached a volume of around 50-100 mm3 (calculated by the formula 4/3(D/2)(d/2)2, where D and d represent the minor and major axis of the tumour, respectively), the maximum tolerated dose of sorafenib (50 mg/kg) was given to the mice by oral gavage daily until the drug resistance occurred, denoted as the drug resistant group. For the control, the wild type group was treated with the vehicle (0.5% CMC-Na). The tumour size and body weight were measured every 3 days.

    Click to Show/Hide
Response regulation Sorafenib treatment triggered ferroptosis via lipid ROS production and chelatable iron accumulation. The ETS1 upregulated by sorafenib was a key transcription factor of miR-23a-3p that directly enhanced miR-23a-3p expression. MiR-23a-3p recognized and bound to ACSL4 3UTR to limit lipid ROS production, thus attenuating sorafenib-induced ferroptotic cell death in hepatocellular carcinoma.
References
Ref 1 Epigenetic regulation of ferroptosis via ETS1/miR-23a-3p/ACSL4 axis mediates sorafenib resistance in human hepatocellular carcinoma. J Exp Clin Cancer Res. 2022 Jan 3;41(1):3. doi: 10.1186/s13046-021-02208-x.
Ref 2 Human umbilical cord blood-derived MSCs exosome attenuate myocardial injury by inhibiting ferroptosis in acute myocardial infarction mice. Cell Biol Toxicol. 2021 Feb;37(1):51-64. doi: 10.1007/s10565-020-09530-8. Epub 2020 Jun 13.