General Information of the Ferroptosis Regulator (ID: REG50012)
Regulator Name hsa-mir-302a (Precursor RNA)
Synonyms
hsa-mir-302a
    Click to Show/Hide
Gene Name hsa-mir-302a
Regulator Type Precursor RNA
MiRBase ID MI0000738
Sequence
CCACCACUUAAACGUGGAUGUACUUGCUUUGAAACUAAAGAAGUAAGUGCUUCCAUGUUU
UGGUGAUGG

    Click to Show/Hide
Full List of the Ferroptosis Target of This Regulator and Corresponding Disease/Drug Response(s)
hsa-mir-302a can regulate the following target(s), and cause disease/drug response(s). You can browse detail information of target(s) or disease/drug response(s).
Browse Target
Browse Disease
Browse Drug
Unspecific Target [Unspecific Target]
In total 1 item(s) under this target
Experiment 1 Reporting the Ferroptosis Target of This Regulator [1]
Responsed Disease Gastric cancer ICD-11: 2B72
Responsed Drug Dexmedetomidine Approved
Pathway Response Ferroptosis hsa04216
Cell Process Cell ferroptosis
In Vitro Model
SNU-1 cells Gastric adenocarcinoma Homo sapiens CVCL_0099
AGS cells Gastric adenocarcinoma Homo sapiens CVCL_0139
GES-1 cells Normal Homo sapiens CVCL_EQ22
In Vivo Model
Female BALB/c nude mice (4-6 weeks old) were obtained from Beijing Institute of Life Sciences (Beijing, China) and the mice were maintained under the standard conditions. AGS cells (2 x 106 cells/mL) were suspended in 100 ul of PBS and were subcutaneously injected in the right flank of mice. After 1 week, mice were divided into four groups (n = 5): Ctrl, 0.5 ug/kg, 1.0 ug/kg, and 2.0 ug/kg groups. The mice were intraperitoneally injected with DEX once a day for 15 days. Mice in the control group were injected with the same amount of normal saline. Tumor size was measured every 2 days and calculated with the formula: 0.5 x length x width2. After the last DEX injection was completed, mice were euthanized with sodium pentobarbital (100 mg/kg) and then sacrificed by decapitation. The tumor tissues were isolated and weighted. Immunohistochemistry for Ki67 and TUNEL assay were performed on paraffin-embedded xenograft tumor tissue sections.

    Click to Show/Hide
Response regulation The current work studied the role of Dexmedetomidine (DEX) in Gastric cancer (GC) cells and discovered that DEX suppressed GC growth by causing ferroptosis. Furthermore, the circ0008035/miR-302a/E2F7 axis was involved in DEX-induced ferroptotic cell death in GC.
Gastric cancer [ICD-11: 2B72]
In total 1 item(s) under this disease
Experiment 1 Reporting the Ferroptosis-centered Disease Response [1]
Target Regulator hsa-mir-302a (Precursor RNA) Precursor RNA
Responsed Drug Dexmedetomidine Approved
Pathway Response Ferroptosis hsa04216
Cell Process Cell ferroptosis
In Vitro Model
SNU-1 cells Gastric adenocarcinoma Homo sapiens CVCL_0099
AGS cells Gastric adenocarcinoma Homo sapiens CVCL_0139
GES-1 cells Normal Homo sapiens CVCL_EQ22
In Vivo Model
Female BALB/c nude mice (4-6 weeks old) were obtained from Beijing Institute of Life Sciences (Beijing, China) and the mice were maintained under the standard conditions. AGS cells (2 x 106 cells/mL) were suspended in 100 ul of PBS and were subcutaneously injected in the right flank of mice. After 1 week, mice were divided into four groups (n = 5): Ctrl, 0.5 ug/kg, 1.0 ug/kg, and 2.0 ug/kg groups. The mice were intraperitoneally injected with DEX once a day for 15 days. Mice in the control group were injected with the same amount of normal saline. Tumor size was measured every 2 days and calculated with the formula: 0.5 x length x width2. After the last DEX injection was completed, mice were euthanized with sodium pentobarbital (100 mg/kg) and then sacrificed by decapitation. The tumor tissues were isolated and weighted. Immunohistochemistry for Ki67 and TUNEL assay were performed on paraffin-embedded xenograft tumor tissue sections.

    Click to Show/Hide
Response regulation The current work studied the role of Dexmedetomidine (DEX) in Gastric cancer (GC) cells and discovered that DEX suppressed GC growth by causing ferroptosis. Furthermore, the circ0008035/miR-302a/E2F7 axis was involved in DEX-induced ferroptotic cell death in GC.
Dexmedetomidine [Approved]
In total 1 item(s) under this drug
Experiment 1 Reporting the Ferroptosis-centered Drug Response [1]
Drug for Ferroptosis Inducer
Response Target Unspecific Target
Responsed Disease Gastric cancer ICD-11: 2B72
Pathway Response Ferroptosis hsa04216
Cell Process Cell ferroptosis
In Vitro Model
SNU-1 cells Gastric adenocarcinoma Homo sapiens CVCL_0099
AGS cells Gastric adenocarcinoma Homo sapiens CVCL_0139
GES-1 cells Normal Homo sapiens CVCL_EQ22
In Vivo Model
Female BALB/c nude mice (4-6 weeks old) were obtained from Beijing Institute of Life Sciences (Beijing, China) and the mice were maintained under the standard conditions. AGS cells (2 x 106 cells/mL) were suspended in 100 ul of PBS and were subcutaneously injected in the right flank of mice. After 1 week, mice were divided into four groups (n = 5): Ctrl, 0.5 ug/kg, 1.0 ug/kg, and 2.0 ug/kg groups. The mice were intraperitoneally injected with DEX once a day for 15 days. Mice in the control group were injected with the same amount of normal saline. Tumor size was measured every 2 days and calculated with the formula: 0.5 x length x width2. After the last DEX injection was completed, mice were euthanized with sodium pentobarbital (100 mg/kg) and then sacrificed by decapitation. The tumor tissues were isolated and weighted. Immunohistochemistry for Ki67 and TUNEL assay were performed on paraffin-embedded xenograft tumor tissue sections.

    Click to Show/Hide
Response regulation The current work studied the role of Dexmedetomidine (DEX) in Gastric cancer (GC) cells and discovered that DEX suppressed GC growth by causing ferroptosis. Furthermore, the circ0008035/miR-302a/E2F7 axis was involved in DEX-induced ferroptotic cell death in GC.
References
Ref 1 Dexmedetomidine promotes ferroptotic cell death in gastric cancer via hsa_circ_0008035/miR-302a/E2F7 axis. Kaohsiung J Med Sci. 2023 Apr;39(4):390-403. doi: 10.1002/kjm2.12650. Epub 2023 Jan 31.