Ferroptosis Regulator Information

General Information of the Ferroptosis Regulator (ID: REG50009)
Regulator Name hsa-mir-132 (Precursor RNA)
Synonyms
hsa-mir-132
    Click to Show/Hide
Gene Name hsa-mir-132
Regulator Type Precursor RNA
MiRBase ID MI0000449
Sequence
CCGCCCCCGCGUCUCCAGGGCAACCGUGGCUUUCGAUUGUUACUGUGGGAACUGGAGGUA
ACAGUCUACAGCCAUGGUCGCCCCGCAGCACGCCCACGCGC

    Click to Show/Hide
Full List of the Ferroptosis Target of This Regulator and Corresponding Disease/Drug Response(s)
hsa-mir-132 can regulate the following target(s), and cause disease/drug response(s). You can browse detail information of target(s) or disease/drug response(s).
Browse Target
Browse Disease
Phospholipid hydroperoxide glutathione peroxidase (GPX4) [Suppressor]
 Target Info 
In total 1 item(s) under this target
Experiment 1 Reporting the Ferroptosis Target of This Regulator [1]
Target for Ferroptosis Suppressor
Responsed Disease Atherosclerosis ICD-11: BD40
 Disease Info 
Pathway Response Ferroptosis hsa04216
Cell Process Cell ferroptosis
In Vitro Model
 HUVECs (Human umbilical vein endothelial cells)
Response regulation MiR-132 promotes atherosclerosis by inducing mitochondrial oxidative stress-mediated ferroptosis, which may serve as a promising therapeutic target for atherosclerosis. The key iron death protein GPX4 was significantly down-regulated and the oxidized protein NOX4 was significantly increased in miR-132-overexpressing HUVECs (P < 0.001).
NADPH oxidase 4 (NOX4) [Driver]
 Target Info 
In total 1 item(s) under this target
Experiment 1 Reporting the Ferroptosis Target of This Regulator [1]
Target for Ferroptosis Driver
Responsed Disease Atherosclerosis ICD-11: BD40
 Disease Info 
Pathway Response Ferroptosis hsa04216
Cell Process Cell ferroptosis
In Vitro Model
 HUVECs (Human umbilical vein endothelial cells)
Response regulation MiR-132 promotes atherosclerosis by inducing mitochondrial oxidative stress-mediated ferroptosis, which may serve as a promising therapeutic target for atherosclerosis. The key iron death protein GPX4 was significantly down-regulated and the oxidized protein NOX4 was significantly increased in miR-132-overexpressing HUVECs (P < 0.001).
Atherosclerosis [ICD-11: BD40]
 Disease Info 
In total 2 item(s) under this disease
Experiment 1 Reporting the Ferroptosis-centered Disease Response [1]
Target Regulator hsa-mir-132 (Precursor RNA) Precursor RNA
 Regulator Info 
Pathway Response Ferroptosis hsa04216
Cell Process Cell ferroptosis
In Vitro Model
 HUVECs (Human umbilical vein endothelial cells)
Response regulation MiR-132 promotes atherosclerosis by inducing mitochondrial oxidative stress-mediated ferroptosis, which may serve as a promising therapeutic target for atherosclerosis. The key iron death protein GPX4 was significantly down-regulated and the oxidized protein NOX4 was significantly increased in miR-132-overexpressing HUVECs (P < 0.001).
Experiment 2 Reporting the Ferroptosis-centered Disease Response [1]
Target Regulator hsa-mir-132 (Precursor RNA) Precursor RNA
 Regulator Info 
Pathway Response Ferroptosis hsa04216
Cell Process Cell ferroptosis
In Vitro Model
 HUVECs (Human umbilical vein endothelial cells)
Response regulation MiR-132 promotes atherosclerosis by inducing mitochondrial oxidative stress-mediated ferroptosis, which may serve as a promising therapeutic target for atherosclerosis. The key iron death protein GPX4 was significantly down-regulated and the oxidized protein NOX4 was significantly increased in miR-132-overexpressing HUVECs (P < 0.001).
References
Ref 1 [MicroRNA-132 promotes atherosclerosis by inducing mitochondrial oxidative stressmediated ferroptosis]. Nan Fang Yi Ke Da Xue Xue Bao. 2022 Jan 20;42(1):143-149. doi: 10.12122/j.issn.1673-4254.2022.01.18.