Ferroptosis Regulator Information

General Information of the Ferroptosis Regulator (ID: REG50003)
Regulator Name hsa-mir-18a (Precursor RNA)
Synonyms
hsa-mir-18a
    Click to Show/Hide
Gene Name hsa-mir-18a
Regulator Type Precursor RNA
MiRBase ID MI0000072
Sequence
UGUUCUAAGGUGCAUCUAGUGCAGAUAGUGAAGUAGAUUAGCAUCUACUGCCCUAAGUGC
UCCUUCUGGCA

    Click to Show/Hide
Full List of the Ferroptosis Target of This Regulator and Corresponding Disease/Drug Response(s)
hsa-mir-18a can regulate the following target(s), and cause disease/drug response(s). You can browse detail information of target(s) or disease/drug response(s).
Browse Target
Browse Disease
Hydroperoxide isomerase ALOXE3 (ALOXE3) [Driver]
 Target Info 
In total 1 item(s) under this target
Experiment 1 Reporting the Ferroptosis Target of This Regulator [1]
Target for Ferroptosis Driver
Responsed Disease Glioblastoma ICD-11: 2A00
 Disease Info 
Pathway Response Fatty acid metabolism hsa01212
Ferroptosis hsa04216
Cell Process Cell ferroptosis
Cell proliferation
Cell migration
In Vitro Model
 U87 MG-Red-Fluc cells Glioblastoma Homo sapiens CVCL_5J12
U-251MG cells Astrocytoma Homo sapiens CVCL_0021
In Vivo Model
The 8-week-old male nude mice were randomly divided into two groups (6 mice per group). The investigators were not blinded to the experimental groups. Orthotopic implantation of GBM cells into the hippocampus of nude mice was performed as we previously described (n = 6). Mice were intraperitoneally injected with luciferin (150 mg/kg; catalog #P1043; Promega) and subjected to IVIS Spectrum in vivo imaging system (PerkinElmer) to determine the intracranial tumor size.

    Click to Show/Hide
Response regulation MiR-18a/ALOXE3 axis exerts tumor promoting functions by regulating ferroptosis and migration of glioblastoma cells. Mechanistically, miR-18a directly targeted ALOXE3 and suppressed its expression and functions in GBM cells.
Long-chain-fatty-acid--CoA ligase 4 (ACSL4) [Driver]
 Target Info 
In total 1 item(s) under this target
Experiment 1 Reporting the Ferroptosis Target of This Regulator [2]
Target for Ferroptosis Driver
Responsed Disease Health ICD-11: N.A.
 Disease Info 
Pathway Response Fatty acid metabolism hsa01212
Ferroptosis hsa04216
Cell Process Cell ferroptosis
Cell proliferation
In Vitro Model
 HUVECs (Human umbilical vein endothelial cells)
Response regulation The upregulated expression of individual miRNAs, miR-17, miR-18a, miR-19a, miR-20a, miR-19b and miR-92 were determined by qRT-PCR. This study revealed a novel mechanism through which miR-17-92 protects endothelial cells from erastin-induced ferroptosis by targeting the A20-ACSL4 axis.
Glioblastoma [ICD-11: 2A00]
 Disease Info 
In total 1 item(s) under this disease
Experiment 1 Reporting the Ferroptosis-centered Disease Response [1]
Target Regulator hsa-mir-18a (Precursor RNA) Precursor RNA
 Regulator Info 
Pathway Response Fatty acid metabolism hsa01212
Ferroptosis hsa04216
Cell Process Cell ferroptosis
Cell proliferation
Cell migration
In Vitro Model
 U87 MG-Red-Fluc cells Glioblastoma Homo sapiens CVCL_5J12
U-251MG cells Astrocytoma Homo sapiens CVCL_0021
In Vivo Model
The 8-week-old male nude mice were randomly divided into two groups (6 mice per group). The investigators were not blinded to the experimental groups. Orthotopic implantation of GBM cells into the hippocampus of nude mice was performed as we previously described (n = 6). Mice were intraperitoneally injected with luciferin (150 mg/kg; catalog #P1043; Promega) and subjected to IVIS Spectrum in vivo imaging system (PerkinElmer) to determine the intracranial tumor size.

    Click to Show/Hide
Response regulation MiR-18a/ALOXE3 axis exerts tumor promoting functions by regulating ferroptosis and migration of glioblastoma cells. Mechanistically, miR-18a directly targeted ALOXE3 and suppressed its expression and functions in GBM cells.
Health [ICD-11: N.A.]
 Disease Info 
In total 1 item(s) under this disease
Experiment 1 Reporting the Ferroptosis-centered Disease Response [2]
Target Regulator hsa-mir-18a (Precursor RNA) Precursor RNA
 Regulator Info 
Pathway Response Fatty acid metabolism hsa01212
Ferroptosis hsa04216
Cell Process Cell ferroptosis
Cell proliferation
In Vitro Model
 HUVECs (Human umbilical vein endothelial cells)
Response regulation The upregulated expression of individual miRNAs, miR-17, miR-18a, miR-19a, miR-20a, miR-19b and miR-92 were determined by qRT-PCR. This study revealed a novel mechanism through which miR-17-92 protects endothelial cells from erastin-induced ferroptosis by targeting the A20-ACSL4 axis.
References
Ref 1 miR-18a promotes glioblastoma development by down-regulating ALOXE3-mediated ferroptotic and anti-migration activities. Oncogenesis. 2021 Feb 12;10(2):15. doi: 10.1038/s41389-021-00304-3.
Ref 2 miRNA-17-92 protects endothelial cells from erastin-induced ferroptosis through targeting the A20-ACSL4 axis. Biochem Biophys Res Commun. 2019 Jul 30;515(3):448-454. doi: 10.1016/j.bbrc.2019.05.147. Epub 2019 May 31.