Ferroptosis Regulator Information

General Information of the Ferroptosis Regulator (ID: REG20133)
Regulator Name hsa-miR-587 (miRNA)
Synonyms
hsa-miR-587
    Click to Show/Hide
Gene Name hsa-miR-587
Regulator Type miRNA
MiRBase ID MIMAT0003253
Sequence
UUUCCAUAGGUGAUGAGUCAC

    Click to Show/Hide
Full List of the Ferroptosis Target of This Regulator and Corresponding Disease/Drug Response(s)
hsa-miR-587 can regulate the following target(s), and cause disease/drug response(s). You can browse detail information of target(s) or disease/drug response(s).
Browse Target
Browse Disease
Cystine/glutamate transporter (SLC7A11) [Driver; Suppressor]
 Target Info 
In total 1 item(s) under this target
Experiment 1 Reporting the Ferroptosis Target of This Regulator [1]
Target for Ferroptosis Suppressor
Responsed Disease Ovarian cancer ICD-11: 2C73
 Disease Info 
Pathway Response Fatty acid metabolism hsa01212
Ferroptosis hsa04216
Cell Process Cell ferroptosis
Cell proliferation
Cell migration
In Vitro Model
 ES-2 cells Ovarian clear cell adenocarcinoma Homo sapiens CVCL_3509
OVCAR-3 cells Ovarian serous adenocarcinoma Homo sapiens CVCL_0465
Caov-3 cells Ovarian serous adenocarcinoma Homo sapiens CVCL_0201
Response regulation ADAMTS9-AS1 regulated SLC7A11 expression through miR-587, thereby affecting ferroptosis, proliferation and migration of Epithelial ovarian cancer cells.
Ovarian cancer [ICD-11: 2C73]
 Disease Info 
In total 1 item(s) under this disease
Experiment 1 Reporting the Ferroptosis-centered Disease Response [1]
Target Regulator hsa-miR-587 (miRNA) miRNA
 Regulator Info 
Pathway Response Fatty acid metabolism hsa01212
Ferroptosis hsa04216
Cell Process Cell ferroptosis
Cell proliferation
Cell migration
In Vitro Model
 ES-2 cells Ovarian clear cell adenocarcinoma Homo sapiens CVCL_3509
OVCAR-3 cells Ovarian serous adenocarcinoma Homo sapiens CVCL_0465
Caov-3 cells Ovarian serous adenocarcinoma Homo sapiens CVCL_0201
Response regulation ADAMTS9-AS1 regulated SLC7A11 expression through miR-587, thereby affecting ferroptosis, proliferation and migration of Epithelial ovarian cancer cells.
References
Ref 1 Long non-coding RNA ADAMTS9-AS1 attenuates ferroptosis by Targeting microRNA-587/solute carrier family 7 member 11 axis in epithelial ovarian cancer. Bioengineered. 2022 Apr;13(4):8226-8239. doi: 10.1080/21655979.2022.2049470.