Ferroptosis Regulator Information

General Information of the Ferroptosis Regulator (ID: REG20131)
Regulator Name hsa-miR-520d-5p (miRNA)
Synonyms
hsa-miR-520d-5p
    Click to Show/Hide
Gene Name hsa-miR-520d-5p
Regulator Type miRNA
MiRBase ID MIMAT0002855
Sequence
CUACAAAGGGAAGCCCUUUC

    Click to Show/Hide
Full List of the Ferroptosis Target of This Regulator and Corresponding Disease/Drug Response(s)
hsa-miR-520d-5p can regulate the following target(s), and cause disease/drug response(s). You can browse detail information of target(s) or disease/drug response(s).
Browse Target
Browse Disease
Cystine/glutamate transporter (SLC7A11) [Driver; Suppressor]
 Target Info 
In total 1 item(s) under this target
Experiment 1 Reporting the Ferroptosis Target of This Regulator [1]
Target for Ferroptosis Suppressor
Responsed Disease Oral squamous cell carcinoma ICD-11: 2B6E
 Disease Info 
Pathway Response Fatty acid metabolism hsa01212
Ferroptosis hsa04216
Cell Process Cell ferroptosis
Cell proliferation
In Vitro Model
 CAL-27 cells Tongue adenosquamous carcinom Homo sapiens CVCL_1107
SCC-15 cells Tongue squamous cell carcinoma Homo sapiens CVCL_1681
In Vivo Model
The tumorigenicity analysis was conducted in BALB/c nude mice (6-weeks-old, male). The mice were maintained at pathogen-free condition. The 5 x 106 CAL27 cells were treated with control shRNA or circFNDC3B shRNA and subcutaneously injected into the nude mice (N = 5). The mice were sacrificed after 30 days and the tumor volume was calculated using the formula of (length x width2)/2.

    Click to Show/Hide
Response regulation CircFNDC3B attenuated ferroptosis of Oral squamous cell carcinoma (OSCC) cells and contributed to OSCC progression by regulating the miR-520d-5p/SLC7A11 axis. CircFNDC3B, miR-520d-5p, and SLC7A11 may serve as potential therapeutic targets of OSCC.
Oral squamous cell carcinoma [ICD-11: 2B6E]
 Disease Info 
In total 1 item(s) under this disease
Experiment 1 Reporting the Ferroptosis-centered Disease Response [1]
Target Regulator hsa-miR-520d-5p (miRNA) miRNA
 Regulator Info 
Pathway Response Fatty acid metabolism hsa01212
Ferroptosis hsa04216
Cell Process Cell ferroptosis
Cell proliferation
In Vitro Model
 CAL-27 cells Tongue adenosquamous carcinom Homo sapiens CVCL_1107
SCC-15 cells Tongue squamous cell carcinoma Homo sapiens CVCL_1681
In Vivo Model
The tumorigenicity analysis was conducted in BALB/c nude mice (6-weeks-old, male). The mice were maintained at pathogen-free condition. The 5 x 106 CAL27 cells were treated with control shRNA or circFNDC3B shRNA and subcutaneously injected into the nude mice (N = 5). The mice were sacrificed after 30 days and the tumor volume was calculated using the formula of (length x width2)/2.

    Click to Show/Hide
Response regulation CircFNDC3B attenuated ferroptosis of Oral squamous cell carcinoma (OSCC) cells and contributed to OSCC progression by regulating the miR-520d-5p/SLC7A11 axis. CircFNDC3B, miR-520d-5p, and SLC7A11 may serve as potential therapeutic targets of OSCC.
References
Ref 1 Circular RNA FNDC3BProtects Oral Squamous Cell Carcinoma Cells From Ferroptosis and Contributes to the Malignant Progression by Regulating miR-520d-5p/SLC7A11 Axis. Front Oncol. 2021 Aug 9;11:672724. doi: 10.3389/fonc.2021.672724. eCollection 2021.