Ferroptosis Regulator Information

General Information of the Ferroptosis Regulator (ID: REG20128)
Regulator Name hsa-miR-497-5p (miRNA)
Synonyms
hsa-miR-497-5p
    Click to Show/Hide
Gene Name hsa-miR-497-5p
Regulator Type miRNA
MiRBase ID MIMAT0002820
Sequence
CAGCAGCACACUGUGGUUUGU

    Click to Show/Hide
Full List of the Ferroptosis Target of This Regulator and Corresponding Disease/Drug Response(s)
hsa-miR-497-5p can regulate the following target(s), and cause disease/drug response(s). You can browse detail information of target(s) or disease/drug response(s).
Browse Target
Browse Disease
Cystine/glutamate transporter (SLC7A11) [Driver; Suppressor]
 Target Info 
In total 2 item(s) under this target
Experiment 1 Reporting the Ferroptosis Target of This Regulator [1]
Target for Ferroptosis Suppressor
Responsed Disease Thyroid cancer ICD-11: 2D10
 Disease Info 
Pathway Response Ferroptosis hsa04216
Cell Process Cell ferroptosis
Cell proliferation
In Vitro Model
 Nthy-ori3-1 cells Normal Homo sapiens CVCL_2659
IHH-4 cells Thyroid gland papillary carcinoma Homo sapiens CVCL_2960
BCPAP cells Thyroid carcinoma Homo sapiens CVCL_0153
KTC-1 cells Thyroid carcinoma Homo sapiens CVCL_6300
TPC-1 cells Thyroid gland papillary carcinoma Homo sapiens CVCL_6298
In Vivo Model
Animal experiments were approved by ethics committee of Wuzhou Red Cross Hospital. The TPC-1 cells transfected with sh-CERS6-AS1 or sh-NC were made into cell suspension (2 x 106/ml) with PBS. Then nude mice were randomly divided into sh-CERS6-AS1 group (n = 6) and sh-NC group (n = 6). The mice were subcutaneously inoculated with 200 ul corresponding cell suspension respectively, and then the weight and tumor volume of mice were recorded every other week. After 5 weeks, pentobarbital sodium (120 mg/kg) were intraperitoneally injected to make nude mice euthanasia, and then the tumors were stripped and weighed. Subsequently, immunohistochemistry and RT-PCR were performed.

    Click to Show/Hide
Response regulation Silencing CERS6-AS1 suppressed cell viability and increased ferroptosis in papillary thyroid cancer. LASP1 was modulated by CERS6-AS1 through sponging miR-497-5p. The expression of Ki67, PCNA, GPX4, and SLC7A11 was inhibited by si-CERS6-AS1 transfection.
Experiment 2 Reporting the Ferroptosis Target of This Regulator [2]
Target for Ferroptosis Suppressor
Responsed Disease Hemangioma ICD-11: 2E81
 Disease Info 
Pathway Response Fatty acid metabolism hsa01212
Ferroptosis hsa04216
Notch signaling pathway hsa04330
Cell Process Cell ferroptosis
Cell proliferation
In Vitro Model
 hHemECs (Human hemangioma endothelial cells)
Response regulation Knockdown of long non-coding RNA MEG8 inhibited the proliferation and induced the ferroptosis of hemangioma endothelial cells by regulating miR-497-5p/NOTCH2 axis. Importantly, silencing MEG8 significantly decreased the expressions of SLC7A11 and GPX4 both in mRNA and protein level and had no effect on the level of AIFM2.
Thyroid cancer [ICD-11: 2D10]
 Disease Info 
In total 1 item(s) under this disease
Experiment 1 Reporting the Ferroptosis-centered Disease Response [1]
Target Regulator hsa-miR-497-5p (miRNA) miRNA
 Regulator Info 
Pathway Response Ferroptosis hsa04216
Cell Process Cell ferroptosis
Cell proliferation
In Vitro Model
 Nthy-ori3-1 cells Normal Homo sapiens CVCL_2659
IHH-4 cells Thyroid gland papillary carcinoma Homo sapiens CVCL_2960
BCPAP cells Thyroid carcinoma Homo sapiens CVCL_0153
KTC-1 cells Thyroid carcinoma Homo sapiens CVCL_6300
TPC-1 cells Thyroid gland papillary carcinoma Homo sapiens CVCL_6298
In Vivo Model
Animal experiments were approved by ethics committee of Wuzhou Red Cross Hospital. The TPC-1 cells transfected with sh-CERS6-AS1 or sh-NC were made into cell suspension (2 x 106/ml) with PBS. Then nude mice were randomly divided into sh-CERS6-AS1 group (n = 6) and sh-NC group (n = 6). The mice were subcutaneously inoculated with 200 ul corresponding cell suspension respectively, and then the weight and tumor volume of mice were recorded every other week. After 5 weeks, pentobarbital sodium (120 mg/kg) were intraperitoneally injected to make nude mice euthanasia, and then the tumors were stripped and weighed. Subsequently, immunohistochemistry and RT-PCR were performed.

    Click to Show/Hide
Response regulation Silencing CERS6-AS1 suppressed cell viability and increased ferroptosis in papillary thyroid cancer. LASP1 was modulated by CERS6-AS1 through sponging miR-497-5p. The expression of Ki67, PCNA, GPX4, and SLC7A11 was inhibited by si-CERS6-AS1 transfection.
Hemangioma [ICD-11: 2E81]
 Disease Info 
In total 1 item(s) under this disease
Experiment 1 Reporting the Ferroptosis-centered Disease Response [2]
Target Regulator hsa-miR-497-5p (miRNA) miRNA
 Regulator Info 
Pathway Response Fatty acid metabolism hsa01212
Ferroptosis hsa04216
Notch signaling pathway hsa04330
Cell Process Cell ferroptosis
Cell proliferation
In Vitro Model
 hHemECs (Human hemangioma endothelial cells)
Response regulation Knockdown of long non-coding RNA MEG8 inhibited the proliferation and induced the ferroptosis of hemangioma endothelial cells by regulating miR-497-5p/NOTCH2 axis. Importantly, silencing MEG8 significantly decreased the expressions of SLC7A11 and GPX4 both in mRNA and protein level and had no effect on the level of AIFM2.
References
Ref 1 CERS6-AS1 Facilitates Oncogenesis and Restrains Ferroptosis in Papillary Thyroid Carcinoma by Serving as a ceRNA through miR-497-5p/LASP1 Axis. Ann Clin Lab Sci. 2022 May;52(3):426-438.
Ref 2 Silencing long non-coding RNA MEG8 inhibits the proliferation and induces the ferroptosis of hemangioma endothelial cells by regulating miR-497-5p/NOTCH2 axis. Biochem Biophys Res Commun. 2021 Jun 4;556:72-78. doi: 10.1016/j.bbrc.2021.03.132. Epub 2021 Apr 8.