Ferroptosis Regulator Information

General Information of the Ferroptosis Regulator (ID: REG20127)
Regulator Name hsa-miR-496 (miRNA)
Synonyms
hsa-miR-496
    Click to Show/Hide
Gene Name hsa-miR-496
Regulator Type miRNA
MiRBase ID MIMAT0002818
Sequence
UGAGUAUUACAUGGCCAAUCUC

    Click to Show/Hide
Full List of the Ferroptosis Target of This Regulator and Corresponding Disease/Drug Response(s)
hsa-miR-496 can regulate the following target(s), and cause disease/drug response(s). You can browse detail information of target(s) or disease/drug response(s).
Browse Target
Browse Disease
Browse Drug
Unspecific Target [Unspecific Target]
In total 1 item(s) under this target
Experiment 1 Reporting the Ferroptosis Target of This Regulator [1]
Responsed Disease Gastric cancer ICD-11: 2B72
 Disease Info 
Responsed Drug Amentoflavone Investigative
 Drug Info 
Pathway Response Fatty acid metabolism hsa01212
Ferroptosis hsa04216
Cell Process Cell ferroptosis
Cell proliferation
In Vitro Model
 GSE-1 (Human gastric mucosal epithelial cells)
AGS cells Gastric adenocarcinoma Homo sapiens CVCL_0139
HGC-27 cells Gastric carcinoma Homo sapiens CVCL_1279
In Vivo Model
The BALB/c nude mice (n = 15, 4-6 weeks old) were purchased from Charles River Labs and kept under controlled conditions. Then 1 x 106 AGS cells were inoculated subcutaneously into nude mice. When the tumor reached to 100 mm3, mice were randomly divided into three groups, the control group was intraperitoneally injected with saline, the AF group was intraperitoneally injected with AF at dosages of 80 mg/kg/day, and AF + anti-miR-496 group received intraperitoneal injection, followed by the administration of miR-496 antagonist via intra-tumor injection once a week for 4 weeks.

    Click to Show/Hide
Response regulation Amentoflavone suppressed the proliferation and induced ferroptotic cell death in gastric cancer cells via miR-496/ATF2 axis, indicating a novel therapeutic approach for GC patients.
Gastric cancer [ICD-11: 2B72]
 Disease Info 
In total 1 item(s) under this disease
Experiment 1 Reporting the Ferroptosis-centered Disease Response [1]
Target Regulator hsa-miR-496 (miRNA) miRNA
 Regulator Info 
Responsed Drug Amentoflavone Investigative
 Drug Info 
Pathway Response Fatty acid metabolism hsa01212
Ferroptosis hsa04216
Cell Process Cell ferroptosis
Cell proliferation
In Vitro Model
 GSE-1 (Human gastric mucosal epithelial cells)
AGS cells Gastric adenocarcinoma Homo sapiens CVCL_0139
HGC-27 cells Gastric carcinoma Homo sapiens CVCL_1279
In Vivo Model
The BALB/c nude mice (n = 15, 4-6 weeks old) were purchased from Charles River Labs and kept under controlled conditions. Then 1 x 106 AGS cells were inoculated subcutaneously into nude mice. When the tumor reached to 100 mm3, mice were randomly divided into three groups, the control group was intraperitoneally injected with saline, the AF group was intraperitoneally injected with AF at dosages of 80 mg/kg/day, and AF + anti-miR-496 group received intraperitoneal injection, followed by the administration of miR-496 antagonist via intra-tumor injection once a week for 4 weeks.

    Click to Show/Hide
Response regulation Amentoflavone suppressed the proliferation and induced ferroptotic cell death in gastric cancer cells via miR-496/ATF2 axis, indicating a novel therapeutic approach for GC patients.
Amentoflavone [Investigative]
 Drug Info 
In total 1 item(s) under this drug
Experiment 1 Reporting the Ferroptosis-centered Drug Response [1]
Drug for Ferroptosis Inducer
Response Target Unspecific Target
Responsed Disease Gastric cancer ICD-11: 2B72
 Disease Info 
Pathway Response Fatty acid metabolism hsa01212
Ferroptosis hsa04216
Cell Process Cell ferroptosis
Cell proliferation
In Vitro Model
 GSE-1 (Human gastric mucosal epithelial cells)
AGS cells Gastric adenocarcinoma Homo sapiens CVCL_0139
HGC-27 cells Gastric carcinoma Homo sapiens CVCL_1279
In Vivo Model
The BALB/c nude mice (n = 15, 4-6 weeks old) were purchased from Charles River Labs and kept under controlled conditions. Then 1 x 106 AGS cells were inoculated subcutaneously into nude mice. When the tumor reached to 100 mm3, mice were randomly divided into three groups, the control group was intraperitoneally injected with saline, the AF group was intraperitoneally injected with AF at dosages of 80 mg/kg/day, and AF + anti-miR-496 group received intraperitoneal injection, followed by the administration of miR-496 antagonist via intra-tumor injection once a week for 4 weeks.

    Click to Show/Hide
Response regulation Amentoflavone suppressed the proliferation and induced ferroptotic cell death in gastric cancer cells via miR-496/ATF2 axis, indicating a novel therapeutic approach for GC patients.
References
Ref 1 Amentoflavone attenuates cell proliferation and induces ferroptosis in human gastric cancer by miR-496/ATF2 axis. Chem Biol Drug Des. 2023 Oct;102(4):782-792. doi: 10.1111/cbdd.14288. Epub 2023 Jul 16.