Ferroptosis Regulator Information

General Information of the Ferroptosis Regulator (ID: REG20126)
Regulator Name hsa-miR-489-3p (miRNA)
Synonyms
hsa-miR-489-3p
    Click to Show/Hide
Gene Name hsa-miR-489-3p
Regulator Type miRNA
MiRBase ID MIMAT0002805
Sequence
GUGACAUCACAUAUACGGCAGC

    Click to Show/Hide
Full List of the Ferroptosis Target of This Regulator and Corresponding Disease/Drug Response(s)
hsa-miR-489-3p can regulate the following target(s), and cause disease/drug response(s). You can browse detail information of target(s) or disease/drug response(s).
Browse Target
Browse Disease
Browse Drug
Cystine/glutamate transporter (SLC7A11) [Driver; Suppressor]
 Target Info 
In total 1 item(s) under this target
Experiment 1 Reporting the Ferroptosis Target of This Regulator [1]
Target for Ferroptosis Suppressor
Responsed Disease Gastric cancer ICD-11: 2B72
 Disease Info 
Responsed Drug Levobupivacaine Approved
 Drug Info 
Pathway Response Fatty acid metabolism hsa01212
Ferroptosis hsa04216
Cell Process Cell ferroptosis
Cell proliferation
In Vitro Model
 GES-1 cells Normal Homo sapiens CVCL_EQ22
HGC-27 cells Gastric carcinoma Homo sapiens CVCL_1279
SGC-7901 cells Gastric carcinoma Homo sapiens CVCL_0520
In Vivo Model
Ten SCID nude mice aged 6-8 weeks were purchased from Vital River Laboratory Animal Technology Co., Ltd. (Beijing, China), and subcutaneously injected with SGC7901 cells (5 x 106 cells per mouse) in left back. One week after feeding, the mice were randomly divided into two groups, the control and treatment group. For the next 25 days, the mice in treatment group were injected with erastin (15 mg/kg intraperitoneally) or co-treated with 40 mol/kg body weight of levobupivacaine once a day. The body weight and tumor size were measured every 3 days.

    Click to Show/Hide
Response regulation Levobupivacaine-upregulated miR-489-3p enhanced ferroptosis of gastric cancer cells by targeting SLC7A11. MiR-489-3p was involved in levobupivacaine-induced ferroptosis of gastric cancer cells. Levobupivacaine/miR-489-3p/SLC7A11 axis attenuates gastric cancer cell proliferationin vitro.
Gastric cancer [ICD-11: 2B72]
 Disease Info 
In total 1 item(s) under this disease
Experiment 1 Reporting the Ferroptosis-centered Disease Response [1]
Target Regulator hsa-miR-489-3p (miRNA) miRNA
 Regulator Info 
Responsed Drug Levobupivacaine Approved
 Drug Info 
Pathway Response Fatty acid metabolism hsa01212
Ferroptosis hsa04216
Cell Process Cell ferroptosis
Cell proliferation
In Vitro Model
 GES-1 cells Normal Homo sapiens CVCL_EQ22
HGC-27 cells Gastric carcinoma Homo sapiens CVCL_1279
SGC-7901 cells Gastric carcinoma Homo sapiens CVCL_0520
In Vivo Model
Ten SCID nude mice aged 6-8 weeks were purchased from Vital River Laboratory Animal Technology Co., Ltd. (Beijing, China), and subcutaneously injected with SGC7901 cells (5 x 106 cells per mouse) in left back. One week after feeding, the mice were randomly divided into two groups, the control and treatment group. For the next 25 days, the mice in treatment group were injected with erastin (15 mg/kg intraperitoneally) or co-treated with 40 mol/kg body weight of levobupivacaine once a day. The body weight and tumor size were measured every 3 days.

    Click to Show/Hide
Response regulation Levobupivacaine-upregulated miR-489-3p enhanced ferroptosis of gastric cancer cells by targeting SLC7A11. MiR-489-3p was involved in levobupivacaine-induced ferroptosis of gastric cancer cells. Levobupivacaine/miR-489-3p/SLC7A11 axis attenuates gastric cancer cell proliferationin vitro.
Levobupivacaine [Approved]
 Drug Info 
In total 1 item(s) under this drug
Experiment 1 Reporting the Ferroptosis-centered Drug Response [1]
Drug for Ferroptosis Inducer
Response Target Cystine/glutamate transporter (SLC7A11) Driver; Suppressor
 Target Info 
Responsed Disease Gastric cancer ICD-11: 2B72
 Disease Info 
Pathway Response Fatty acid metabolism hsa01212
Ferroptosis hsa04216
Cell Process Cell ferroptosis
Cell proliferation
In Vitro Model
 GES-1 cells Normal Homo sapiens CVCL_EQ22
HGC-27 cells Gastric carcinoma Homo sapiens CVCL_1279
SGC-7901 cells Gastric carcinoma Homo sapiens CVCL_0520
In Vivo Model
Ten SCID nude mice aged 6-8 weeks were purchased from Vital River Laboratory Animal Technology Co., Ltd. (Beijing, China), and subcutaneously injected with SGC7901 cells (5 x 106 cells per mouse) in left back. One week after feeding, the mice were randomly divided into two groups, the control and treatment group. For the next 25 days, the mice in treatment group were injected with erastin (15 mg/kg intraperitoneally) or co-treated with 40 mol/kg body weight of levobupivacaine once a day. The body weight and tumor size were measured every 3 days.

    Click to Show/Hide
Response regulation Levobupivacaine-upregulated miR-489-3p enhanced ferroptosis of gastric cancer cells by targeting SLC7A11. MiR-489-3p was involved in levobupivacaine-induced ferroptosis of gastric cancer cells. Levobupivacaine/miR-489-3p/SLC7A11 axis attenuates gastric cancer cell proliferationin vitro.
References
Ref 1 Levobupivacaine Induces Ferroptosis by miR-489-3p/SLC7A11 Signaling in Gastric Cancer. Front Pharmacol. 2021 Jun 9;12:681338. doi: 10.3389/fphar.2021.681338. eCollection 2021.