Ferroptosis Regulator Information

General Information of the Ferroptosis Regulator (ID: REG20118)
Regulator Name hsa-miR-143-3p (miRNA)
Synonyms
hsa-miR-143-3p
    Click to Show/Hide
Gene Name hsa-miR-143-3p
Regulator Type miRNA
MiRBase ID MIMAT0000435
Sequence
UGAGAUGAAGCACUGUAGCUC

    Click to Show/Hide
Full List of the Ferroptosis Target of This Regulator and Corresponding Disease/Drug Response(s)
hsa-miR-143-3p can regulate the following target(s), and cause disease/drug response(s). You can browse detail information of target(s) or disease/drug response(s).
Browse Target
Browse Disease
Cystine/glutamate transporter (SLC7A11) [Driver; Suppressor]
 Target Info 
In total 2 item(s) under this target
Experiment 1 Reporting the Ferroptosis Target of This Regulator [1]
Target for Ferroptosis Suppressor
Responsed Disease Hereditary Leiomyomatosis ICD-11: 2C90
 Disease Info 
Pathway Response Fatty acid metabolism hsa01212
Ferroptosis hsa04216
Cell Process Cell ferroptosis
Cell proliferation
Cell migration
In Vitro Model
 HK-2 cells Normal Homo sapiens CVCL_0302
Response regulation SLC16A1-AS1 served as a sponge of miR-143-3p, and knockdown SLC16A1-AS1 significantly increased the enrichment of miR-143-3p. And then, SLC7A11 was identified as the target protein of miR-143-3p, and overexpression miR-143-3p remarkably inhibited the expression of SLC7A11. And silencing lncRNA SLC16A1-AS1 can induce ferroptosis through miR-143-3p/SLC7A11 signaling in renal cell carcinoma.
Experiment 2 Reporting the Ferroptosis Target of This Regulator [2]
Target for Ferroptosis Suppressor
Responsed Disease Ischemia/reperfusion injury ICD-11: DB98
 Disease Info 
Pathway Response Fatty acid metabolism hsa01212
Cell Process Cell ferroptosis
In Vitro Model
 AC16 [Human hybrid cardiomyocyte] cells Normal Homo sapiens CVCL_4U18
Response regulation SEMA5A-IT1 overexpression upregulated the expression of BCL2 and SLC7A11 through sponging miR-143-3p, thereby protecting cardiomyocytes against apoptotic and ferroptosis cell death. In conclusion, we propose that SEMA5A-IT1, which is transported to cardiomyocytes through circulating sEVs, is an important regulatory molecule that protects cardiomyocytes from ischemia-reperfusion injury.
Hereditary Leiomyomatosis [ICD-11: 2C90]
 Disease Info 
In total 1 item(s) under this disease
Experiment 1 Reporting the Ferroptosis-centered Disease Response [1]
Target Regulator hsa-miR-143-3p (miRNA) miRNA
 Regulator Info 
Pathway Response Fatty acid metabolism hsa01212
Ferroptosis hsa04216
Cell Process Cell ferroptosis
Cell proliferation
Cell migration
In Vitro Model
 HK-2 cells Normal Homo sapiens CVCL_0302
Response regulation SLC16A1-AS1 served as a sponge of miR-143-3p, and knockdown SLC16A1-AS1 significantly increased the enrichment of miR-143-3p. And then, SLC7A11 was identified as the target protein of miR-143-3p, and overexpression miR-143-3p remarkably inhibited the expression of SLC7A11. And silencing lncRNA SLC16A1-AS1 can induce ferroptosis through miR-143-3p/SLC7A11 signaling in renal cell carcinoma.
Ischemia/reperfusion injury [ICD-11: DB98]
 Disease Info 
In total 1 item(s) under this disease
Experiment 1 Reporting the Ferroptosis-centered Disease Response [2]
Target Regulator hsa-miR-143-3p (miRNA) miRNA
 Regulator Info 
Pathway Response Fatty acid metabolism hsa01212
Cell Process Cell ferroptosis
In Vitro Model
 AC16 [Human hybrid cardiomyocyte] cells Normal Homo sapiens CVCL_4U18
Response regulation SEMA5A-IT1 overexpression upregulated the expression of BCL2 and SLC7A11 through sponging miR-143-3p, thereby protecting cardiomyocytes against apoptotic and ferroptosis cell death. In conclusion, we propose that SEMA5A-IT1, which is transported to cardiomyocytes through circulating sEVs, is an important regulatory molecule that protects cardiomyocytes from ischemia-reperfusion injury.
References
Ref 1 Silencing lncRNA SLC16A1-AS1 Induced Ferroptosis in Renal Cell Carcinoma Through miR-143-3p/SLC7A11 Signaling. Technol Cancer Res Treat. 2022 Jan-Dec;21:15330338221077803. doi: 10.1177/15330338221077803.
Ref 2 Circulating small extracellular vesicle-encapsulated SEMA5A-IT1 attenuates myocardial ischemia-reperfusion injury after cardiac surgery with cardiopulmonary bypass. Cell Mol Biol Lett. 2022 Oct 25;27(1):95. doi: 10.1186/s11658-022-00395-9.