Ferroptosis Regulator Information

General Information of the Ferroptosis Regulator (ID: REG20117)
Regulator Name hsa-miR-142-5p (miRNA)
Synonyms
hsa-miR-142-5p
    Click to Show/Hide
Gene Name hsa-miR-142-5p
Regulator Type miRNA
MiRBase ID MIMAT0000433
Sequence
CAUAAAGUAGAAAGCACUACU

    Click to Show/Hide
Full List of the Ferroptosis Target of This Regulator and Corresponding Disease/Drug Response(s)
hsa-miR-142-5p can regulate the following target(s), and cause disease/drug response(s). You can browse detail information of target(s) or disease/drug response(s).
Browse Target
Browse Disease
Phospholipid hydroperoxide glutathione peroxidase (GPX4) [Suppressor]
 Target Info 
In total 1 item(s) under this target
Experiment 1 Reporting the Ferroptosis Target of This Regulator [1]
Target for Ferroptosis Suppressor
Responsed Disease Hematotoxicity ICD-11: 3A70
 Disease Info 
Pathway Response Ferroptosis hsa04216
Cell Process Cell ferroptosis
In Vitro Model
 AHH-1 cells Normal Homo sapiens CVCL_3640
Response regulation Lnc-TC/ miR-142-5p/CUL4B signaling axis promoted cell ferroptosis to participate in benzene hematotoxicity, and was a potential biomarker for risk screening and health surveillance of benzene-exposed workers. The expression of GPX4 was negatively correlated with both Lnc-TC and CUL4B.
Hematotoxicity [ICD-11: 3A70]
 Disease Info 
In total 1 item(s) under this disease
Experiment 1 Reporting the Ferroptosis-centered Disease Response [1]
Target Regulator hsa-miR-142-5p (miRNA) miRNA
 Regulator Info 
Pathway Response Ferroptosis hsa04216
Cell Process Cell ferroptosis
In Vitro Model
 AHH-1 cells Normal Homo sapiens CVCL_3640
Response regulation Lnc-TC/ miR-142-5p/CUL4B signaling axis promoted cell ferroptosis to participate in benzene hematotoxicity, and was a potential biomarker for risk screening and health surveillance of benzene-exposed workers. The expression of GPX4 was negatively correlated with both Lnc-TC and CUL4B.
References
Ref 1 Lnc-TC/miR-142-5p/CUL4B signaling axis promoted cell ferroptosis to participate in benzene hematotoxicity. Life Sci. 2022 Dec 1;310:121111. doi: 10.1016/j.lfs.2022.121111. Epub 2022 Oct 20.