Ferroptosis Regulator Information

General Information of the Ferroptosis Regulator (ID: REG20115)
Regulator Name hsa-miR-125b-5p (miRNA)
Synonyms
hsa-miR-125b-5p
    Click to Show/Hide
Gene Name hsa-miR-125b-5p
Regulator Type miRNA
MiRBase ID MIMAT0000423
Sequence
UCCCUGAGACCCUAACUUGUGA

    Click to Show/Hide
Full List of the Ferroptosis Target of This Regulator and Corresponding Disease/Drug Response(s)
hsa-miR-125b-5p can regulate the following target(s), and cause disease/drug response(s). You can browse detail information of target(s) or disease/drug response(s).
Browse Target
Browse Disease
Cystine/glutamate transporter (SLC7A11) [Driver; Suppressor]
 Target Info 
In total 1 item(s) under this target
Experiment 1 Reporting the Ferroptosis Target of This Regulator [1]
Target for Ferroptosis Suppressor
Responsed Disease Oral squamous cell carcinoma ICD-11: 2B6E
 Disease Info 
Pathway Response Fatty acid metabolism hsa01212
Ferroptosis hsa04216
Cell Process Cell ferroptosis
In Vitro Model
 Tca8113 cells Endocervical adenocarcinoma Homo sapiens CVCL_6851
TSCCA cells Endocervical adenocarcinoma Homo sapiens CVCL_VL15
CAL-27 cells Tongue adenosquamous carcinom Homo sapiens CVCL_1107
SCC-9 cells Tongue squamous cell carcinoma Homo sapiens CVCL_1685
hTECs (Human tongue epithelial cells)
Response regulation EZH2 inhibits the ferroptosis of tongue squamous cell carcinoma cells by inhibiting miR-125b-5p and enhancing SLC7A11. MiR-125b-5p regulates ferroptosis in TSCC cells by targeting SLC7A11.
Oral squamous cell carcinoma [ICD-11: 2B6E]
 Disease Info 
In total 1 item(s) under this disease
Experiment 1 Reporting the Ferroptosis-centered Disease Response [1]
Target Regulator hsa-miR-125b-5p (miRNA) miRNA
 Regulator Info 
Pathway Response Fatty acid metabolism hsa01212
Ferroptosis hsa04216
Cell Process Cell ferroptosis
In Vitro Model
 Tca8113 cells Endocervical adenocarcinoma Homo sapiens CVCL_6851
TSCCA cells Endocervical adenocarcinoma Homo sapiens CVCL_VL15
CAL-27 cells Tongue adenosquamous carcinom Homo sapiens CVCL_1107
SCC-9 cells Tongue squamous cell carcinoma Homo sapiens CVCL_1685
hTECs (Human tongue epithelial cells)
Response regulation EZH2 inhibits the ferroptosis of tongue squamous cell carcinoma cells by inhibiting miR-125b-5p and enhancing SLC7A11. MiR-125b-5p regulates ferroptosis in TSCC cells by targeting SLC7A11.
References
Ref 1 EZH2-mediated SLC7A11 upregulation via miR-125b-5p represses ferroptosis of TSCC. Oral Dis. 2023 Apr;29(3):880-891. doi: 10.1111/odi.14040. Epub 2021 Nov 15.