Ferroptosis Regulator Information

General Information of the Ferroptosis Regulator (ID: REG20114)
Regulator Name hsa-miR-122-5p (miRNA)
Synonyms
hsa-miR-122-5p
    Click to Show/Hide
Gene Name hsa-miR-122-5p
Regulator Type miRNA
MiRBase ID MIMAT0000421
Sequence
UGGAGUGUGACAAUGGUGUUUG

    Click to Show/Hide
Full List of the Ferroptosis Target of This Regulator and Corresponding Disease/Drug Response(s)
hsa-miR-122-5p can regulate the following target(s), and cause disease/drug response(s). You can browse detail information of target(s) or disease/drug response(s).
Browse Target
Browse Disease
Browse Drug
Cystine/glutamate transporter (SLC7A11) [Driver; Suppressor]
 Target Info 
In total 1 item(s) under this target
Experiment 1 Reporting the Ferroptosis Target of This Regulator [1]
Target for Ferroptosis Suppressor
Responsed Disease Intracerebral hemorrhage ICD-11: 8B00
 Disease Info 
Responsed Drug Isorhynchophylline Investigative
 Drug Info 
Pathway Response Fatty acid metabolism hsa01212
Ferroptosis hsa04216
p53 signaling pathway hsa04115
Cell Process Cell ferroptosis
Cell proliferation
In Vitro Model
 HT22 cells Normal Mus musculus CVCL_0321
In Vivo Model
Adult male Sprague-Dawley rats (SD rats, weighing 250-300 g) aged 11-12 weeks were purchased from SLAC Laboratory Animal Co., Ltd. (Shanghai, China). All 96 rats were randomly divided into four groups of 24 rats each: Sham group, Sham + IRN (30 mg/Kg) group, ICH group, and ICH + IRN (30 mg/Kg) group. The rats in sham group were injected with PBS solution, and the Sham + IRN (30 mg/Kg) group was received an equal amount of 30 mg/Kg IRN solution (intra-peritoneal injection) after the sham operation. After ICH, the rats in ICH group were injected with PBS solution, and the ICH + IRN (30 mg/Kg) group was received an equal amount of 30 mg/Kg IRN solution (intra-peritoneal injection).

    Click to Show/Hide
Response regulation Isorhynchophylline (IRN) decreased ferroptosis and lipid ROS level, upregulated the expression of miR-122-5p and SLC7A11 mRNA, and inhibited TP53 expression. In conclusion, IRN protects neurocyte from intracerebral hemorrhage (ICH)-induced ferroptosis via miR-122-5p/TP53/SLC7A11 pathway, which may provide a potential therapeutic mechanism for ICH.
Intracerebral hemorrhage [ICD-11: 8B00]
 Disease Info 
In total 1 item(s) under this disease
Experiment 1 Reporting the Ferroptosis-centered Disease Response [1]
Target Regulator hsa-miR-122-5p (miRNA) miRNA
 Regulator Info 
Responsed Drug Isorhynchophylline Investigative
 Drug Info 
Pathway Response Fatty acid metabolism hsa01212
Ferroptosis hsa04216
p53 signaling pathway hsa04115
Cell Process Cell ferroptosis
Cell proliferation
In Vitro Model
 HT22 cells Normal Mus musculus CVCL_0321
In Vivo Model
Adult male Sprague-Dawley rats (SD rats, weighing 250-300 g) aged 11-12 weeks were purchased from SLAC Laboratory Animal Co., Ltd. (Shanghai, China). All 96 rats were randomly divided into four groups of 24 rats each: Sham group, Sham + IRN (30 mg/Kg) group, ICH group, and ICH + IRN (30 mg/Kg) group. The rats in sham group were injected with PBS solution, and the Sham + IRN (30 mg/Kg) group was received an equal amount of 30 mg/Kg IRN solution (intra-peritoneal injection) after the sham operation. After ICH, the rats in ICH group were injected with PBS solution, and the ICH + IRN (30 mg/Kg) group was received an equal amount of 30 mg/Kg IRN solution (intra-peritoneal injection).

    Click to Show/Hide
Response regulation Isorhynchophylline (IRN) decreased ferroptosis and lipid ROS level, upregulated the expression of miR-122-5p and SLC7A11 mRNA, and inhibited TP53 expression. In conclusion, IRN protects neurocyte from intracerebral hemorrhage (ICH)-induced ferroptosis via miR-122-5p/TP53/SLC7A11 pathway, which may provide a potential therapeutic mechanism for ICH.
Isorhynchophylline [Investigative]
 Drug Info 
In total 1 item(s) under this drug
Experiment 1 Reporting the Ferroptosis-centered Drug Response [1]
Drug for Ferroptosis Suppressor
Response Target Cystine/glutamate transporter (SLC7A11) Driver; Suppressor
 Target Info 
Responsed Disease Intracerebral hemorrhage ICD-11: 8B00
 Disease Info 
Pathway Response Fatty acid metabolism hsa01212
Ferroptosis hsa04216
p53 signaling pathway hsa04115
Cell Process Cell ferroptosis
Cell proliferation
In Vitro Model
 HT22 cells Normal Mus musculus CVCL_0321
In Vivo Model
Adult male Sprague-Dawley rats (SD rats, weighing 250-300 g) aged 11-12 weeks were purchased from SLAC Laboratory Animal Co., Ltd. (Shanghai, China). All 96 rats were randomly divided into four groups of 24 rats each: Sham group, Sham + IRN (30 mg/Kg) group, ICH group, and ICH + IRN (30 mg/Kg) group. The rats in sham group were injected with PBS solution, and the Sham + IRN (30 mg/Kg) group was received an equal amount of 30 mg/Kg IRN solution (intra-peritoneal injection) after the sham operation. After ICH, the rats in ICH group were injected with PBS solution, and the ICH + IRN (30 mg/Kg) group was received an equal amount of 30 mg/Kg IRN solution (intra-peritoneal injection).

    Click to Show/Hide
Response regulation Isorhynchophylline (IRN) decreased ferroptosis and lipid ROS level, upregulated the expression of miR-122-5p and SLC7A11 mRNA, and inhibited TP53 expression. In conclusion, IRN protects neurocyte from intracerebral hemorrhage (ICH)-induced ferroptosis via miR-122-5p/TP53/SLC7A11 pathway, which may provide a potential therapeutic mechanism for ICH.
References
Ref 1 Isorhynchophylline Relieves Ferroptosis-Induced Nerve Damage after Intracerebral Hemorrhage Via miR-122-5p/TP53/SLC7A11 Pathway. Neurochem Res. 2021 Aug;46(8):1981-1994. doi: 10.1007/s11064-021-03320-2. Epub 2021 May 3.