Ferroptosis Regulator Information

General Information of the Ferroptosis Regulator (ID: REG20113)
Regulator Name hsa-miR-200b-3p (miRNA)
Synonyms
hsa-miR-200b-3p
    Click to Show/Hide
Gene Name hsa-miR-200b-3p
Regulator Type miRNA
MiRBase ID MIMAT0000318
Sequence
UAAUACUGCCUGGUAAUGAUGA

    Click to Show/Hide
Full List of the Ferroptosis Target of This Regulator and Corresponding Disease/Drug Response(s)
hsa-miR-200b-3p can regulate the following target(s), and cause disease/drug response(s). You can browse detail information of target(s) or disease/drug response(s).
Browse Target
Browse Disease
Transferrin receptor protein 1 (TFRC) [Driver; Suppressor; Marker]
 Target Info 
In total 1 item(s) under this target
Experiment 1 Reporting the Ferroptosis Target of This Regulator [1]
Target for Ferroptosis Marker/Suppressor/Driver
Responsed Disease Retinopathy ICD-11: 9B71
 Disease Info 
Pathway Response Glutathione metabolism hsa00480
Ferroptosis hsa04216
Cell Process Cell ferroptosis
In Vitro Model
 ARPE-19 cells Normal Homo sapiens CVCL_0145
Response regulation Downregulation of circ-PSEN1 ameliorates HG-induced ferroptosis in ARPE19 cells via miR-200b-3p/CFL2 and may be a novel therapeutic target for diabetic retinopathy. Enhancement of CFL2 suppressed the mRNA and protein expression of GPX4 and SLC7A11. However, TFR1 expression was promoted.
Phospholipid hydroperoxide glutathione peroxidase (GPX4) [Suppressor]
 Target Info 
In total 1 item(s) under this target
Experiment 1 Reporting the Ferroptosis Target of This Regulator [1]
Target for Ferroptosis Suppressor
Responsed Disease Retinopathy ICD-11: 9B71
 Disease Info 
Pathway Response Glutathione metabolism hsa00480
Ferroptosis hsa04216
Cell Process Cell ferroptosis
In Vitro Model
 ARPE-19 cells Normal Homo sapiens CVCL_0145
Response regulation Downregulation of circ-PSEN1 ameliorates HG-induced ferroptosis in ARPE19 cells via miR-200b-3p/CFL2 and may be a novel therapeutic target for diabetic retinopathy. Enhancement of CFL2 suppressed the mRNA and protein expression of GPX4 and SLC7A11. However, TFR1 expression was promoted.
Retinopathy [ICD-11: 9B71]
 Disease Info 
In total 2 item(s) under this disease
Experiment 1 Reporting the Ferroptosis-centered Disease Response [1]
Target Regulator hsa-miR-200b-3p (miRNA) miRNA
 Regulator Info 
Pathway Response Glutathione metabolism hsa00480
Ferroptosis hsa04216
Cell Process Cell ferroptosis
In Vitro Model
 ARPE-19 cells Normal Homo sapiens CVCL_0145
Response regulation Downregulation of circ-PSEN1 ameliorates HG-induced ferroptosis in ARPE19 cells via miR-200b-3p/CFL2 and may be a novel therapeutic target for diabetic retinopathy. Enhancement of CFL2 suppressed the mRNA and protein expression of GPX4 and SLC7A11. However, TFR1 expression was promoted.
Experiment 2 Reporting the Ferroptosis-centered Disease Response [1]
Target Regulator hsa-miR-200b-3p (miRNA) miRNA
 Regulator Info 
Pathway Response Glutathione metabolism hsa00480
Ferroptosis hsa04216
Cell Process Cell ferroptosis
In Vitro Model
 ARPE-19 cells Normal Homo sapiens CVCL_0145
Response regulation Downregulation of circ-PSEN1 ameliorates HG-induced ferroptosis in ARPE19 cells via miR-200b-3p/CFL2 and may be a novel therapeutic target for diabetic retinopathy. Enhancement of CFL2 suppressed the mRNA and protein expression of GPX4 and SLC7A11. However, TFR1 expression was promoted.
References
Ref 1 Downregulation of Circular RNA PSEN1 ameliorates ferroptosis of the high glucose treated retinal pigment epithelial cells via miR-200b-3p/cofilin-2 axis. Bioengineered. 2021 Dec;12(2):12555-12567. doi: 10.1080/21655979.2021.2010369.