Ferroptosis Regulator Information

General Information of the Ferroptosis Regulator (ID: REG20109)
Regulator Name hsa-miR-30a-5p (miRNA)
Synonyms
hsa-miR-30a-5p
    Click to Show/Hide
Gene Name hsa-miR-30a-5p
Regulator Type miRNA
MiRBase ID MIMAT0000087
Sequence
UGUAAACAUCCUCGACUGGAAG

    Click to Show/Hide
Full List of the Ferroptosis Target of This Regulator and Corresponding Disease/Drug Response(s)
hsa-miR-30a-5p can regulate the following target(s), and cause disease/drug response(s). You can browse detail information of target(s) or disease/drug response(s).
Browse Target
Browse Disease
Phospholipid hydroperoxide glutathione peroxidase (GPX4) [Suppressor]
 Target Info 
In total 1 item(s) under this target
Experiment 1 Reporting the Ferroptosis Target of This Regulator [1]
Target for Ferroptosis Suppressor
Responsed Disease Oesophageal cancer ICD-11: 2B70
 Disease Info 
Pathway Response Wnt signaling pathway hsa04310
Fatty acid metabolism hsa01212
Cell Process Cell ferroptosis
Cell proliferation
Cell invasion
In Vitro Model
 EC9706 cells Esophageal squamous cell carcinoma Homo sapiens CVCL_E307
KYSE-70 cells Esophageal squamous cell carcinoma Homo sapiens CVCL_1356
hEECs (Human esophageal epithelial cells)
In Vivo Model
BALB/c nude male mice of 4 weeks old were purchased from the Model Animal Research Center of Nanjing University (Nanjing, China). After one week of adaptive feeding, EC9706 cells (3 x 106) stably expressing sh-NC and sh-circPVT1, sh-NC + 5-FU and sh-circPVT1 + 5-FU were subcutaneously were injected into the right flank of the nude mice in a serum-free DMEM medium.

    Click to Show/Hide
Response regulation CircPVT1 regulated the chemosensitivity of esophageal squamous cell carcinoma cells through ROS and Wnt/-catenin pathwaysvia miR-30a-5p/FZD3. Knockdown of circPVT1 promoted chemosensitivity in ESCC by increasing ferroptosis via downregulating GPX4 and SLC7A11.
Cystine/glutamate transporter (SLC7A11) [Driver; Suppressor]
 Target Info 
In total 1 item(s) under this target
Experiment 1 Reporting the Ferroptosis Target of This Regulator [1]
Target for Ferroptosis Suppressor
Responsed Disease Oesophageal cancer ICD-11: 2B70
 Disease Info 
Pathway Response Wnt signaling pathway hsa04310
Fatty acid metabolism hsa01212
Cell Process Cell ferroptosis
Cell proliferation
Cell invasion
In Vitro Model
 EC9706 cells Esophageal squamous cell carcinoma Homo sapiens CVCL_E307
KYSE-70 cells Esophageal squamous cell carcinoma Homo sapiens CVCL_1356
hEECs (Human esophageal epithelial cells)
In Vivo Model
BALB/c nude male mice of 4 weeks old were purchased from the Model Animal Research Center of Nanjing University (Nanjing, China). After one week of adaptive feeding, EC9706 cells (3 x 106) stably expressing sh-NC and sh-circPVT1, sh-NC + 5-FU and sh-circPVT1 + 5-FU were subcutaneously were injected into the right flank of the nude mice in a serum-free DMEM medium.

    Click to Show/Hide
Response regulation CircPVT1 regulated the chemosensitivity of esophageal squamous cell carcinoma cells through ROS and Wnt/-catenin pathways via miR-30a-5p/FZD3. Knockdown of circPVT1 promoted chemosensitivity in ESCC by increasing ferroptosis via downregulating GPX4 and SLC7A11.
Oesophageal cancer [ICD-11: 2B70]
 Disease Info 
In total 2 item(s) under this disease
Experiment 1 Reporting the Ferroptosis-centered Disease Response [1]
Target Regulator hsa-miR-30a-5p (miRNA) miRNA
 Regulator Info 
Pathway Response Wnt signaling pathway hsa04310
Fatty acid metabolism hsa01212
Cell Process Cell ferroptosis
Cell proliferation
Cell invasion
In Vitro Model
 EC9706 cells Esophageal squamous cell carcinoma Homo sapiens CVCL_E307
KYSE-70 cells Esophageal squamous cell carcinoma Homo sapiens CVCL_1356
hEECs (Human esophageal epithelial cells)
In Vivo Model
BALB/c nude male mice of 4 weeks old were purchased from the Model Animal Research Center of Nanjing University (Nanjing, China). After one week of adaptive feeding, EC9706 cells (3 x 106) stably expressing sh-NC and sh-circPVT1, sh-NC + 5-FU and sh-circPVT1 + 5-FU were subcutaneously were injected into the right flank of the nude mice in a serum-free DMEM medium.

    Click to Show/Hide
Response regulation CircPVT1 regulated the chemosensitivity of esophageal squamous cell carcinoma cells through ROS and Wnt/-catenin pathwaysvia miR-30a-5p/FZD3. Knockdown of circPVT1 promoted chemosensitivity in ESCC by increasing ferroptosis via downregulating GPX4 and SLC7A11.
Experiment 2 Reporting the Ferroptosis-centered Disease Response [1]
Target Regulator hsa-miR-30a-5p (miRNA) miRNA
 Regulator Info 
Pathway Response Wnt signaling pathway hsa04310
Fatty acid metabolism hsa01212
Cell Process Cell ferroptosis
Cell proliferation
Cell invasion
In Vitro Model
 EC9706 cells Esophageal squamous cell carcinoma Homo sapiens CVCL_E307
KYSE-70 cells Esophageal squamous cell carcinoma Homo sapiens CVCL_1356
hEECs (Human esophageal epithelial cells)
In Vivo Model
BALB/c nude male mice of 4 weeks old were purchased from the Model Animal Research Center of Nanjing University (Nanjing, China). After one week of adaptive feeding, EC9706 cells (3 x 106) stably expressing sh-NC and sh-circPVT1, sh-NC + 5-FU and sh-circPVT1 + 5-FU were subcutaneously were injected into the right flank of the nude mice in a serum-free DMEM medium.

    Click to Show/Hide
Response regulation CircPVT1 regulated the chemosensitivity of esophageal squamous cell carcinoma cells through ROS and Wnt/-catenin pathways via miR-30a-5p/FZD3. Knockdown of circPVT1 promoted chemosensitivity in ESCC by increasing ferroptosis via downregulating GPX4 and SLC7A11.
References
Ref 1 Circular RNA CircPVT1 Inhibits 5-Fluorouracil Chemosensitivity by Regulating Ferroptosis Through MiR-30a-5p/FZD3 Axis in Esophageal Cancer Cells. Front Oncol. 2021 Dec 13;11:780938. doi: 10.3389/fonc.2021.780938. eCollection 2021.