General Information of the Ferroptosis Regulator (ID: REG20089)
Regulator Name hsa-miR-545-3p (miRNA)
Synonyms
hsa-miR-545-3p
    Click to Show/Hide
Gene Name hsa-miR-545-3p
Regulator Type miRNA
MiRBase ID MIMAT0003165
Sequence
UCAGCAAACAUUUAUUGUGUGC

    Click to Show/Hide
Full List of the Ferroptosis Target of This Regulator and Corresponding Disease/Drug Response(s)
hsa-miR-545-3p can regulate the following target(s), and cause disease/drug response(s). You can browse detail information of target(s) or disease/drug response(s).
Browse Target
Browse Disease
Serotransferrin (TF) [Driver; Suppressor; Marker]
In total 1 item(s) under this target
Experiment 1 Reporting the Ferroptosis Target of This Regulator [1]
Target for Ferroptosis Marker/Suppressor/Driver
Responsed Disease Colorectal cancer ICD-11: 2B91
Pathway Response Ferroptosis hsa04216
Cell Process Cell ferroptosis
In Vitro Model
NCM460 cells Normal Homo sapiens CVCL_0460
HT-29 cells Colon adenocarcinoma Homo sapiens CVCL_0320
HCT 116 cells Colon carcinoma Homo sapiens CVCL_0291
LoVo cells Colon adenocarcinoma Homo sapiens CVCL_0399
In Vivo Model
5-week-old immunodeficient nude mice (male, weight, 16-20 g, n = 40 mice for each group) were purchased from Cyagen bio. Co. (Beijing, China). Before experiments, the mice were adapted to the breeding environment for two weeks. All mice were maintained at a 12 h/12 h light/dark cycle with free access to water and food. A total of 5 x 106 HT-29 or HCT-116 cells were suspended in 100 uL PBS and injected subcutaneously into the right posterior flanks of nude mice. After three weeks, the mice were killed and the tumor xenografts were dissected, weighed and fixed in 10% buffered formaldehyde for further IHC analysis.

    Click to Show/Hide
Response regulation MiR-545 inhibits ferroptosis in colorectal cancer cells by inhibiting TF. TF overexpression blocked miR-545-induced changes in ROS, MDA, and Fe2+ levels in HT-29 and HCT-116 cells, thereby inducing CRC cell death.
Cystine/glutamate transporter (SLC7A11) [Driver; Suppressor]
In total 1 item(s) under this target
Experiment 1 Reporting the Ferroptosis Target of This Regulator [2]
Target for Ferroptosis Suppressor
Responsed Disease Thyroid cancer ICD-11: 2D10
Pathway Response Fatty acid metabolism hsa01212
Ferroptosis hsa04216
Apoptosis hsa04210
Cell Process Cell ferroptosis
Cell apoptosis
Cell proliferation
In Vitro Model
FTC-133 cells Thyroid gland follicular carcinoma Homo sapiens CVCL_1219
TPC-1 cells Thyroid gland papillary carcinoma Homo sapiens CVCL_6298
In Vivo Model
BALB/c nude mice (18-20 g, 4-week-old, male) (n = 6) were purchased and applied for the tumor growth analysis of FTC133 cellsin vivo. About 1 x 106 FTC133 cells were transfected with control shRNA or circ_0067934 shRNA and were subcutaneously injected into the left fat pad of mice. After 5 days of injection, we measured tumor growth every 5 days. We sacrificed the mice after 30 days of injection. The tumor volume was calculated by (length x width2)/2. And the tumor weight was calculated at day 30.

    Click to Show/Hide
Response regulation Circ_0067934 upregulated the expression of the ferroptosis-negative regulator SLC7A11 by sponging and inhibiting miR-545-3p in thyroid cancer cells. The overexpression of SLC7A11 or the inhibitor of miR-545-3p reversed circ_0067934 silencing-regulated thyroid cancer cell proliferation.
Colorectal cancer [ICD-11: 2B91]
In total 1 item(s) under this disease
Experiment 1 Reporting the Ferroptosis-centered Disease Response [1]
Target Regulator hsa-miR-545-3p (miRNA) miRNA
Pathway Response Ferroptosis hsa04216
Cell Process Cell ferroptosis
In Vitro Model
NCM460 cells Normal Homo sapiens CVCL_0460
HT-29 cells Colon adenocarcinoma Homo sapiens CVCL_0320
HCT 116 cells Colon carcinoma Homo sapiens CVCL_0291
LoVo cells Colon adenocarcinoma Homo sapiens CVCL_0399
In Vivo Model
5-week-old immunodeficient nude mice (male, weight, 16-20 g, n = 40 mice for each group) were purchased from Cyagen bio. Co. (Beijing, China). Before experiments, the mice were adapted to the breeding environment for two weeks. All mice were maintained at a 12 h/12 h light/dark cycle with free access to water and food. A total of 5 x 106 HT-29 or HCT-116 cells were suspended in 100 uL PBS and injected subcutaneously into the right posterior flanks of nude mice. After three weeks, the mice were killed and the tumor xenografts were dissected, weighed and fixed in 10% buffered formaldehyde for further IHC analysis.

    Click to Show/Hide
Response regulation MiR-545 inhibits ferroptosis in colorectal cancer cells by inhibiting TF. TF overexpression blocked miR-545-induced changes in ROS, MDA, and Fe2+ levels in HT-29 and HCT-116 cells, thereby inducing CRC cell death.
Thyroid cancer [ICD-11: 2D10]
In total 1 item(s) under this disease
Experiment 1 Reporting the Ferroptosis-centered Disease Response [2]
Target Regulator hsa-miR-545-3p (miRNA) miRNA
Pathway Response Fatty acid metabolism hsa01212
Ferroptosis hsa04216
Apoptosis hsa04210
Cell Process Cell ferroptosis
Cell apoptosis
Cell proliferation
In Vitro Model
FTC-133 cells Thyroid gland follicular carcinoma Homo sapiens CVCL_1219
TPC-1 cells Thyroid gland papillary carcinoma Homo sapiens CVCL_6298
In Vivo Model
BALB/c nude mice (18-20 g, 4-week-old, male) (n = 6) were purchased and applied for the tumor growth analysis of FTC133 cellsin vivo. About 1 x 106 FTC133 cells were transfected with control shRNA or circ_0067934 shRNA and were subcutaneously injected into the left fat pad of mice. After 5 days of injection, we measured tumor growth every 5 days. We sacrificed the mice after 30 days of injection. The tumor volume was calculated by (length x width2)/2. And the tumor weight was calculated at day 30.

    Click to Show/Hide
Response regulation Circ_0067934 upregulated the expression of the ferroptosis-negative regulator SLC7A11 by sponging and inhibiting miR-545-3p in thyroid cancer cells. The overexpression of SLC7A11 or the inhibitor of miR-545-3p reversed circ_0067934 silencing-regulated thyroid cancer cell proliferation.
References
Ref 1 miR-545 promotes colorectal cancer by inhibiting transferring in the non-normal ferroptosis signaling. Aging (Albany NY). 2021 Dec 26;13(24):26137-26147. doi: 10.18632/aging.203801. Epub 2021 Dec 26.
Ref 2 Circular RNA Circ_0067934 Attenuates Ferroptosis of Thyroid Cancer Cells by miR-545-3p/SLC7A11 Signaling. Front Endocrinol (Lausanne). 2021 Jul 5;12:670031. doi: 10.3389/fendo.2021.670031. eCollection 2021.