Ferroptosis Regulator Information

General Information of the Ferroptosis Regulator (ID: REG20068)
Regulator Name hsa-miR-194-5p (miRNA)
Synonyms
hsa-miR-194-5p
    Click to Show/Hide
Gene Name hsa-miR-194-5p
Regulator Type miRNA
MiRBase ID MIMAT0000460
Sequence
UGUAACAGCAACUCCAUGUGGA

    Click to Show/Hide
Full List of the Ferroptosis Target of This Regulator and Corresponding Disease/Drug Response(s)
hsa-miR-194-5p can regulate the following target(s), and cause disease/drug response(s). You can browse detail information of target(s) or disease/drug response(s).
Browse Target
Browse Disease
Cystine/glutamate transporter (SLC7A11) [Driver; Suppressor]
 Target Info 
In total 1 item(s) under this target
Experiment 1 Reporting the Ferroptosis Target of This Regulator [1]
Target for Ferroptosis Suppressor
Responsed Disease Ovarian cancer ICD-11: 2C73
 Disease Info 
Pathway Response Fatty acid metabolism hsa01212
Cell Process Cell ferroptosis
In Vitro Model
 SK-OV-3 cells Ovarian serous cystadenocarcinoma Homo sapiens CVCL_0532
A2780 cells Ovarian endometrioid adenocarcinoma Homo sapiens CVCL_0134
Response regulation circSnx12 can be a molecular sponge of miR-194-5p, which targets SLC7A11. According to our findings, circSnx12 ameliorates cisplatin resistance by blocking ferroptosis via a miR-194-5p/SLC7A11 pathway. CircARNT2 may thus serve as an effective therapeutic target for overcoming cisplatin resistance in ovarian cancer.
Ovarian cancer [ICD-11: 2C73]
 Disease Info 
In total 1 item(s) under this disease
Experiment 1 Reporting the Ferroptosis-centered Disease Response [1]
Target Regulator hsa-miR-194-5p (miRNA) miRNA
 Regulator Info 
Pathway Response Fatty acid metabolism hsa01212
Cell Process Cell ferroptosis
In Vitro Model
 SK-OV-3 cells Ovarian serous cystadenocarcinoma Homo sapiens CVCL_0532
A2780 cells Ovarian endometrioid adenocarcinoma Homo sapiens CVCL_0134
Response regulation circSnx12 can be a molecular sponge of miR-194-5p, which targets SLC7A11. According to our findings, circSnx12 ameliorates cisplatin resistance by blocking ferroptosis via a miR-194-5p/SLC7A11 pathway. CircARNT2 may thus serve as an effective therapeutic target for overcoming cisplatin resistance in ovarian cancer.
References
Ref 1 circRNA circSnx12 confers Cisplatin chemoresistance to ovarian cancer by inhibiting ferroptosis through a miR-194-5p/SLC7A11 axis. BMB Rep. 2023 Mar;56(2):184-189. doi: 10.5483/BMBRep.2022-0175.