General Information of the Ferroptosis Regulator (ID: REG20061)
Regulator Name hsa-miR-5096 (miRNA)
Synonyms
hsa-miR-5096
    Click to Show/Hide
Gene Name hsa-miR-5096
Regulator Type miRNA
MiRBase ID MIMAT0020603
Sequence
GUUUCACCAUGUUGGUCAGGC

    Click to Show/Hide
Full List of the Ferroptosis Target of This Regulator and Corresponding Disease/Drug Response(s)
hsa-miR-5096 can regulate the following target(s), and cause disease/drug response(s). You can browse detail information of target(s) or disease/drug response(s).
Browse Target
Browse Disease
Long-chain-fatty-acid--CoA ligase 4 (ACSL4) [Driver]
In total 1 item(s) under this target
Experiment 1 Reporting the Ferroptosis Target of This Regulator [1]
Target for Ferroptosis Driver
Responsed Disease Breast cancer ICD-11: 2C60
Pathway Response Fatty acid metabolism hsa01212
Ferroptosis hsa04216
Cell Process Cell ferroptosis
In Vitro Model
MDA-MB-468 cells Breast adenocarcinoma Homo sapiens CVCL_0419
MDA-MB-453 cells Breast adenocarcinoma Homo sapiens CVCL_0418
BT-549 cells Invasive breast carcinoma Homo sapiens CVCL_1092
MDA-MB-231 cells Breast adenocarcinoma Homo sapiens CVCL_0062
SK-BR-3 cells Breast adenocarcinoma Homo sapiens CVCL_0033
T-47D cells Invasive breast carcinoma Homo sapiens CVCL_0553
MCF-7 cells Breast carcinoma Homo sapiens CVCL_0031
ZR-75-1 cells Invasive breast carcinoma Homo sapiens CVCL_0588
MCF-10A cells Normal Homo sapiens CVCL_0598
In Vivo Model
Mating was setup 2 days prior to injection day and zebrafish embryos were collected and incubated in E3 embryo medium (5 mM NaCl, 0.17 mM KCl, 10 mM HEPES, 0.33 mM MgSO4·7H2O, 0.33 mM CaCl2·6H2O, and 0.00001% methylene blue) containing 0.2 mM N-phenyl-thiourea (PTU) (catalog no: P7629, Sigma-Aldrich). Two days post-fertilization, the chorion was removed manually using fine forceps, and the embryos were anesthetized using E3 medium containing 200 mg/L Ethyl 3-aminobenzoate methanesulfonate (Tricaine) (catalog no: A5040, Sigma-Aldrich). Anesthetized embryos were mounted in 0.7% low melting agarose containing 200 ug/ml of Tricaine and were microinjected with 500 cells in the yolk sac using Nanoject III (catalog no: 3-000-207; Drummond Scientific Company, PA, USA). At 1 day post-injection (dpi), embryos with similar graft size were selected and imaged using both bright field and RFP channels and incubated in E3-PTU medium containing 5 ug/ml doxycycline at 34 until further imaging. At 4 dpi, embryos were anesthetized and imaged again using both bright field and RFP channels using Olympus IX-73 microscope. Cells that migrated outside the yolk sac (injection site) were represented by a notable fluorescent dot and considered a metastatic event; these were counted manually for all embryos in each experimental group.

    Click to Show/Hide
Response regulation The present study demonstrated that miR-5096 targets and downregulates SLC7A11, thereby providing a mechanistic basis for ferroptosis in human breast cancer cells. In addition, miR-5096 induced cell death via ferroptosis, characterized by mitochondrial shrinkage with partial loss of cristae with simultaneous changes in ACSL4, ROS, lipid ROS, OH-, reactive iron, GSH, and MMP levels.
Cystine/glutamate transporter (SLC7A11) [Driver; Suppressor]
In total 1 item(s) under this target
Experiment 1 Reporting the Ferroptosis Target of This Regulator [1]
Target for Ferroptosis Suppressor
Responsed Disease Breast cancer ICD-11: 2C60
Pathway Response Fatty acid metabolism hsa01212
Ferroptosis hsa04216
Cell Process Cell ferroptosis
In Vitro Model
MDA-MB-468 cells Breast adenocarcinoma Homo sapiens CVCL_0419
MDA-MB-453 cells Breast adenocarcinoma Homo sapiens CVCL_0418
BT-549 cells Invasive breast carcinoma Homo sapiens CVCL_1092
MDA-MB-231 cells Breast adenocarcinoma Homo sapiens CVCL_0062
SK-BR-3 cells Breast adenocarcinoma Homo sapiens CVCL_0033
T-47D cells Invasive breast carcinoma Homo sapiens CVCL_0553
MCF-7 cells Breast carcinoma Homo sapiens CVCL_0031
ZR-75-1 cells Invasive breast carcinoma Homo sapiens CVCL_0588
MCF-10A cells Normal Homo sapiens CVCL_0598
In Vivo Model
Mating was setup 2 days prior to injection day and zebrafish embryos were collected and incubated in E3 embryo medium (5 mM NaCl, 0.17 mM KCl, 10 mM HEPES, 0.33 mM MgSO4·7H2O, 0.33 mM CaCl2·6H2O, and 0.00001% methylene blue) containing 0.2 mM N-phenyl-thiourea (PTU) (catalog no: P7629, Sigma-Aldrich). Two days post-fertilization, the chorion was removed manually using fine forceps, and the embryos were anesthetized using E3 medium containing 200 mg/L Ethyl 3-aminobenzoate methanesulfonate (Tricaine) (catalog no: A5040, Sigma-Aldrich). Anesthetized embryos were mounted in 0.7% low melting agarose containing 200 ug/ml of Tricaine and were microinjected with 500 cells in the yolk sac using Nanoject III (catalog no: 3-000-207; Drummond Scientific Company, PA, USA). At 1 day post-injection (dpi), embryos with similar graft size were selected and imaged using both bright field and RFP channels and incubated in E3-PTU medium containing 5 ug/ml doxycycline at 34 until further imaging. At 4 dpi, embryos were anesthetized and imaged again using both bright field and RFP channels using Olympus IX-73 microscope. Cells that migrated outside the yolk sac (injection site) were represented by a notable fluorescent dot and considered a metastatic event; these were counted manually for all embryos in each experimental group.

    Click to Show/Hide
Response regulation The present study demonstrated that miR-5096 targets and downregulates SLC7A11, thereby providing a mechanistic basis for ferroptosis in human breast cancer cells. In addition, miR-5096 induced cell death via ferroptosis, characterized by mitochondrial shrinkage with partial loss of cristae with simultaneous changes in ACSL4, ROS, lipid ROS, OH-, reactive iron, GSH, and MMP levels.
Breast cancer [ICD-11: 2C60]
In total 2 item(s) under this disease
Experiment 1 Reporting the Ferroptosis-centered Disease Response [1]
Target Regulator hsa-miR-5096 (miRNA) miRNA
Pathway Response Fatty acid metabolism hsa01212
Ferroptosis hsa04216
Cell Process Cell ferroptosis
In Vitro Model
MDA-MB-468 cells Breast adenocarcinoma Homo sapiens CVCL_0419
MDA-MB-453 cells Breast adenocarcinoma Homo sapiens CVCL_0418
BT-549 cells Invasive breast carcinoma Homo sapiens CVCL_1092
MDA-MB-231 cells Breast adenocarcinoma Homo sapiens CVCL_0062
SK-BR-3 cells Breast adenocarcinoma Homo sapiens CVCL_0033
T-47D cells Invasive breast carcinoma Homo sapiens CVCL_0553
MCF-7 cells Breast carcinoma Homo sapiens CVCL_0031
ZR-75-1 cells Invasive breast carcinoma Homo sapiens CVCL_0588
MCF-10A cells Normal Homo sapiens CVCL_0598
In Vivo Model
Mating was setup 2 days prior to injection day and zebrafish embryos were collected and incubated in E3 embryo medium (5 mM NaCl, 0.17 mM KCl, 10 mM HEPES, 0.33 mM MgSO4·7H2O, 0.33 mM CaCl2·6H2O, and 0.00001% methylene blue) containing 0.2 mM N-phenyl-thiourea (PTU) (catalog no: P7629, Sigma-Aldrich). Two days post-fertilization, the chorion was removed manually using fine forceps, and the embryos were anesthetized using E3 medium containing 200 mg/L Ethyl 3-aminobenzoate methanesulfonate (Tricaine) (catalog no: A5040, Sigma-Aldrich). Anesthetized embryos were mounted in 0.7% low melting agarose containing 200 ug/ml of Tricaine and were microinjected with 500 cells in the yolk sac using Nanoject III (catalog no: 3-000-207; Drummond Scientific Company, PA, USA). At 1 day post-injection (dpi), embryos with similar graft size were selected and imaged using both bright field and RFP channels and incubated in E3-PTU medium containing 5 ug/ml doxycycline at 34 until further imaging. At 4 dpi, embryos were anesthetized and imaged again using both bright field and RFP channels using Olympus IX-73 microscope. Cells that migrated outside the yolk sac (injection site) were represented by a notable fluorescent dot and considered a metastatic event; these were counted manually for all embryos in each experimental group.

    Click to Show/Hide
Response regulation The present study demonstrated that miR-5096 targets and downregulates SLC7A11, thereby providing a mechanistic basis for ferroptosis in human breast cancer cells. In addition, miR-5096 induced cell death via ferroptosis, characterized by mitochondrial shrinkage with partial loss of cristae with simultaneous changes in ACSL4, ROS, lipid ROS, OH-, reactive iron, GSH, and MMP levels.
Experiment 2 Reporting the Ferroptosis-centered Disease Response [1]
Target Regulator hsa-miR-5096 (miRNA) miRNA
Pathway Response Fatty acid metabolism hsa01212
Ferroptosis hsa04216
Cell Process Cell ferroptosis
In Vitro Model
MDA-MB-468 cells Breast adenocarcinoma Homo sapiens CVCL_0419
MDA-MB-453 cells Breast adenocarcinoma Homo sapiens CVCL_0418
BT-549 cells Invasive breast carcinoma Homo sapiens CVCL_1092
MDA-MB-231 cells Breast adenocarcinoma Homo sapiens CVCL_0062
SK-BR-3 cells Breast adenocarcinoma Homo sapiens CVCL_0033
T-47D cells Invasive breast carcinoma Homo sapiens CVCL_0553
MCF-7 cells Breast carcinoma Homo sapiens CVCL_0031
ZR-75-1 cells Invasive breast carcinoma Homo sapiens CVCL_0588
MCF-10A cells Normal Homo sapiens CVCL_0598
In Vivo Model
Mating was setup 2 days prior to injection day and zebrafish embryos were collected and incubated in E3 embryo medium (5 mM NaCl, 0.17 mM KCl, 10 mM HEPES, 0.33 mM MgSO4·7H2O, 0.33 mM CaCl2·6H2O, and 0.00001% methylene blue) containing 0.2 mM N-phenyl-thiourea (PTU) (catalog no: P7629, Sigma-Aldrich). Two days post-fertilization, the chorion was removed manually using fine forceps, and the embryos were anesthetized using E3 medium containing 200 mg/L Ethyl 3-aminobenzoate methanesulfonate (Tricaine) (catalog no: A5040, Sigma-Aldrich). Anesthetized embryos were mounted in 0.7% low melting agarose containing 200 ug/ml of Tricaine and were microinjected with 500 cells in the yolk sac using Nanoject III (catalog no: 3-000-207; Drummond Scientific Company, PA, USA). At 1 day post-injection (dpi), embryos with similar graft size were selected and imaged using both bright field and RFP channels and incubated in E3-PTU medium containing 5 ug/ml doxycycline at 34 until further imaging. At 4 dpi, embryos were anesthetized and imaged again using both bright field and RFP channels using Olympus IX-73 microscope. Cells that migrated outside the yolk sac (injection site) were represented by a notable fluorescent dot and considered a metastatic event; these were counted manually for all embryos in each experimental group.

    Click to Show/Hide
Response regulation The present study demonstrated that miR-5096 targets and downregulates SLC7A11, thereby providing a mechanistic basis for ferroptosis in human breast cancer cells. In addition, miR-5096 induced cell death via ferroptosis, characterized by mitochondrial shrinkage with partial loss of cristae with simultaneous changes in ACSL4, ROS, lipid ROS, OH-, reactive iron, GSH, and MMP levels.
References
Ref 1 SLC7A11/ xCT is a target of miR-5096 and its restoration partially rescues miR-5096-mediated ferroptosis and anti-tumor effects in human breast cancer cells. Cancer Lett. 2021 Dec 1;522:211-224. doi: 10.1016/j.canlet.2021.09.033. Epub 2021 Sep 24.