Ferroptosis Regulator Information

General Information of the Ferroptosis Regulator (ID: REG20060)
Regulator Name hsa-miR-4735-3p (miRNA)
Synonyms
hsa-miR-4735-3p
    Click to Show/Hide
Gene Name hsa-miR-4735-3p
Regulator Type miRNA
MiRBase ID MIMAT0019861
Sequence
AAAGGUGCUCAAAUUAGACAU

    Click to Show/Hide
Full List of the Ferroptosis Target of This Regulator and Corresponding Disease/Drug Response(s)
hsa-miR-4735-3p can regulate the following target(s), and cause disease/drug response(s). You can browse detail information of target(s) or disease/drug response(s).
Browse Target
Browse Disease
Solute carrier family 40 member 1 (SLC40A1) [Suppressor; Marker]
 Target Info 
In total 1 item(s) under this target
Experiment 1 Reporting the Ferroptosis Target of This Regulator [1]
Target for Ferroptosis Marker/Suppressor
Responsed Disease Hereditary Leiomyomatosis ICD-11: 2C90
 Disease Info 
Pathway Response Fatty acid metabolism hsa01212
Ferroptosis hsa04216
Cell Process Cell ferroptosis
Cell proliferation
Cell migration
Cell invasion
In Vitro Model
 786-O cells Renal cell carcinoma Homo sapiens CVCL_1051
A-498 cells Renal cell carcinoma Homo sapiens CVCL_1056
HK-2 cells Normal Homo sapiens CVCL_0302
Response regulation The miR-4735-3p mimic increased, while the miR-4735-3p inhibitor decreased oxidative stress, lipid peroxidation, iron overload, and ferroptosis of human Clear cell renal cell carcinoma (ccRCC) cell lines. Mechanistic studies identified SLC40A1 as a direct target of miR-4735-3p.
Hereditary Leiomyomatosis [ICD-11: 2C90]
 Disease Info 
In total 1 item(s) under this disease
Experiment 1 Reporting the Ferroptosis-centered Disease Response [1]
Target Regulator hsa-miR-4735-3p (miRNA) miRNA
 Regulator Info 
Pathway Response Fatty acid metabolism hsa01212
Ferroptosis hsa04216
Cell Process Cell ferroptosis
Cell proliferation
Cell migration
Cell invasion
In Vitro Model
 786-O cells Renal cell carcinoma Homo sapiens CVCL_1051
A-498 cells Renal cell carcinoma Homo sapiens CVCL_1056
HK-2 cells Normal Homo sapiens CVCL_0302
Response regulation The miR-4735-3p mimic increased, while the miR-4735-3p inhibitor decreased oxidative stress, lipid peroxidation, iron overload, and ferroptosis of human Clear cell renal cell carcinoma (ccRCC) cell lines. Mechanistic studies identified SLC40A1 as a direct target of miR-4735-3p.
References
Ref 1 MicroRNA-4735-3p Facilitates Ferroptosis in Clear Cell Renal Cell Carcinoma by Targeting SLC40A1. Anal Cell Pathol (Amst). 2022 May 19;2022:4213401. doi: 10.1155/2022/4213401. eCollection 2022.