General Information of the Ferroptosis Regulator (ID: REG20056)
Regulator Name rno-miR-196c-3p (miRNA)
Synonyms
rno-miR-196c-3p
    Click to Show/Hide
Gene Name rno-miR-196c-3p
Regulator Type miRNA
MiRBase ID MIMAT0017299
Sequence
ACAACAACACCAAACCACCUGA

    Click to Show/Hide
Full List of the Ferroptosis Target of This Regulator and Corresponding Disease/Drug Response(s)
rno-miR-196c-3p can regulate the following target(s), and cause disease/drug response(s). You can browse detail information of target(s) or disease/drug response(s).
Browse Target
Browse Disease
Polyunsaturated fatty acid lipoxygenase ALOX15 (ALOX15) [Driver]
In total 1 item(s) under this target
Experiment 1 Reporting the Ferroptosis Target of This Regulator [1]
Target for Ferroptosis Driver
Responsed Disease Cerebral ischemia ICD-11: 8B10
Pathway Response Fatty acid metabolism hsa01212
Cell Process Cell ferroptosis
In Vitro Model
CHO-S/H9C2 cells Normal Cricetulus griseus CVCL_A0TS
In Vivo Model
Wild-type SD rats were kept in the Animal Experiment Center of Southeast University. Experimental rats were divided into 4 groups (n = 6 per group). The method of establishing the I/R model was provided in supplementary material. Then, we covered the ligation with gel. In order to fully cover the infarcted area of the heart, we chose to inject about 300 uL of mimics + Gel at 23 mm below the left atrial appendage (about the ligation). In order to prevent excessive irradiation of tissue burns, we selected each irradiation for 2 min to control the body surface temperature for a total of 10 min of irradiation.

    Click to Show/Hide
Response regulation The mir-196c-3p mimic (mimics) and photothermal nanoparticles (BTN) were co-encapsulated in an injectable Gel (mimics + Gel/BTN) with NIR-II light-triggered release. Consequently, declined ferroptosis in cardiomyocytes and improved cardiac function, survival rate in rats was achieved through the controlled release of Gel/BTN mimics in cerebral ischemia-reperfusion injury model to simultaneously inhibit ferroptosis hub genes NOX4, P53, and ALOX15 expression.
NADPH oxidase 4 (NOX4) [Driver]
In total 1 item(s) under this target
Experiment 1 Reporting the Ferroptosis Target of This Regulator [1]
Target for Ferroptosis Driver
Responsed Disease Cerebral ischemia ICD-11: 8B10
Pathway Response Fatty acid metabolism hsa01212
Cell Process Cell ferroptosis
In Vitro Model
CHO-S/H9C2 cells Normal Cricetulus griseus CVCL_A0TS
In Vivo Model
Wild-type SD rats were kept in the Animal Experiment Center of Southeast University. Experimental rats were divided into 4 groups (n = 6 per group). The method of establishing the I/R model was provided in supplementary material. Then, we covered the ligation with gel. In order to fully cover the infarcted area of the heart, we chose to inject about 300 uL of mimics + Gel at 23 mm below the left atrial appendage (about the ligation). In order to prevent excessive irradiation of tissue burns, we selected each irradiation for 2 min to control the body surface temperature for a total of 10 min of irradiation.

    Click to Show/Hide
Response regulation The mir-196c-3p mimic (mimics) and photothermal nanoparticles (BTN) were co-encapsulated in an injectable Gel (mimics + Gel/BTN) with NIR-II light-triggered release. Consequently, declined ferroptosis in cardiomyocytes and improved cardiac function, survival rate in rats was achieved through the controlled release of Gel/BTN mimics in cerebral ischemia-reperfusion injury model to simultaneously inhibit ferroptosis hub genes NOX4, P53, and ALOX15 expression.
Unspecific Target [Unspecific Target]
In total 1 item(s) under this target
Experiment 1 Reporting the Ferroptosis Target of This Regulator [1]
Responsed Disease Cerebral ischemia ICD-11: 8B10
Pathway Response Fatty acid metabolism hsa01212
Cell Process Cell ferroptosis
In Vitro Model
CHO-S/H9C2 cells Normal Cricetulus griseus CVCL_A0TS
In Vivo Model
Wild-type SD rats were kept in the Animal Experiment Center of Southeast University. Experimental rats were divided into 4 groups (n = 6 per group). The method of establishing the I/R model was provided in supplementary material. Then, we covered the ligation with gel. In order to fully cover the infarcted area of the heart, we chose to inject about 300 uL of mimics + Gel at 23 mm below the left atrial appendage (about the ligation). In order to prevent excessive irradiation of tissue burns, we selected each irradiation for 2 min to control the body surface temperature for a total of 10 min of irradiation.

    Click to Show/Hide
Response regulation The mir-196c-3p mimic (mimics) and photothermal nanoparticles (BTN) were co-encapsulated in an injectable Gel (mimics + Gel/BTN) with NIR-II light-triggered release. Consequently, declined ferroptosis in cardiomyocytes and improved cardiac function, survival rate in rats was achieved through the controlled release of Gel/BTN mimics in ischemia-reperfusion (I/R) model to simultaneously inhibit ferroptosis hub genes NOX4, P53, and LOX expression.
Cerebral ischemia [ICD-11: 8B10]
In total 3 item(s) under this disease
Experiment 1 Reporting the Ferroptosis-centered Disease Response [1]
Target Regulator rno-miR-196c-3p (miRNA) miRNA
Pathway Response Fatty acid metabolism hsa01212
Cell Process Cell ferroptosis
In Vitro Model
CHO-S/H9C2 cells Normal Cricetulus griseus CVCL_A0TS
In Vivo Model
Wild-type SD rats were kept in the Animal Experiment Center of Southeast University. Experimental rats were divided into 4 groups (n = 6 per group). The method of establishing the I/R model was provided in supplementary material. Then, we covered the ligation with gel. In order to fully cover the infarcted area of the heart, we chose to inject about 300 uL of mimics + Gel at 23 mm below the left atrial appendage (about the ligation). In order to prevent excessive irradiation of tissue burns, we selected each irradiation for 2 min to control the body surface temperature for a total of 10 min of irradiation.

    Click to Show/Hide
Response regulation The mir-196c-3p mimic (mimics) and photothermal nanoparticles (BTN) were co-encapsulated in an injectable Gel (mimics + Gel/BTN) with NIR-II light-triggered release. Consequently, declined ferroptosis in cardiomyocytes and improved cardiac function, survival rate in rats was achieved through the controlled release of Gel/BTN mimics in cerebral ischemia-reperfusion injury model to simultaneously inhibit ferroptosis hub genes NOX4, P53, and ALOX15 expression.
Experiment 2 Reporting the Ferroptosis-centered Disease Response [1]
Target Regulator rno-miR-196c-3p (miRNA) miRNA
Pathway Response Fatty acid metabolism hsa01212
Cell Process Cell ferroptosis
In Vitro Model
CHO-S/H9C2 cells Normal Cricetulus griseus CVCL_A0TS
In Vivo Model
Wild-type SD rats were kept in the Animal Experiment Center of Southeast University. Experimental rats were divided into 4 groups (n = 6 per group). The method of establishing the I/R model was provided in supplementary material. Then, we covered the ligation with gel. In order to fully cover the infarcted area of the heart, we chose to inject about 300 uL of mimics + Gel at 23 mm below the left atrial appendage (about the ligation). In order to prevent excessive irradiation of tissue burns, we selected each irradiation for 2 min to control the body surface temperature for a total of 10 min of irradiation.

    Click to Show/Hide
Response regulation The mir-196c-3p mimic (mimics) and photothermal nanoparticles (BTN) were co-encapsulated in an injectable Gel (mimics + Gel/BTN) with NIR-II light-triggered release. Consequently, declined ferroptosis in cardiomyocytes and improved cardiac function, survival rate in rats was achieved through the controlled release of Gel/BTN mimics in cerebral ischemia-reperfusion injury model to simultaneously inhibit ferroptosis hub genes NOX4, P53, and ALOX15 expression.
Experiment 3 Reporting the Ferroptosis-centered Disease Response [1]
Target Regulator rno-miR-196c-3p (miRNA) miRNA
Pathway Response Fatty acid metabolism hsa01212
Cell Process Cell ferroptosis
In Vitro Model
CHO-S/H9C2 cells Normal Cricetulus griseus CVCL_A0TS
In Vivo Model
Wild-type SD rats were kept in the Animal Experiment Center of Southeast University. Experimental rats were divided into 4 groups (n = 6 per group). The method of establishing the I/R model was provided in supplementary material. Then, we covered the ligation with gel. In order to fully cover the infarcted area of the heart, we chose to inject about 300 uL of mimics + Gel at 23 mm below the left atrial appendage (about the ligation). In order to prevent excessive irradiation of tissue burns, we selected each irradiation for 2 min to control the body surface temperature for a total of 10 min of irradiation.

    Click to Show/Hide
Response regulation The mir-196c-3p mimic (mimics) and photothermal nanoparticles (BTN) were co-encapsulated in an injectable Gel (mimics + Gel/BTN) with NIR-II light-triggered release. Consequently, declined ferroptosis in cardiomyocytes and improved cardiac function, survival rate in rats was achieved through the controlled release of Gel/BTN mimics in ischemia-reperfusion (I/R) model to simultaneously inhibit ferroptosis hub genes NOX4, P53, and LOX expression.
References
Ref 1 Delivery of Mir-196c-3p with NIR-II light-triggered gel attenuates cardiomyocyte ferroptosis in cardiac ischemia-reperfusion injury. Nanomedicine. 2023 Jan;47:102618. doi: 10.1016/j.nano.2022.102618. Epub 2022 Oct 18.