General Information of the Ferroptosis Regulator (ID: REG20055)
Regulator Name hsa-miR-2115-3p (miRNA)
Synonyms
hsa-miR-2115-3p
    Click to Show/Hide
Gene Name hsa-miR-2115-3p
Regulator Type miRNA
MiRBase ID MIMAT0011159
Sequence
CAUCAGAAUUCAUGGAGGCUAG

    Click to Show/Hide
Full List of the Ferroptosis Target of This Regulator and Corresponding Disease/Drug Response(s)
hsa-miR-2115-3p can regulate the following target(s), and cause disease/drug response(s). You can browse detail information of target(s) or disease/drug response(s).
Browse Target
Browse Disease
Aspartate aminotransferase, cytoplasmic (GOT1) [Driver; Suppressor]
In total 1 item(s) under this target
Experiment 1 Reporting the Ferroptosis Target of This Regulator [1]
Target for Ferroptosis Driver
Responsed Disease Preeclampsia ICD-11: JA24
Pathway Response Ferroptosis hsa04216
Cell Process Cell ferroptosis
In Vitro Model
HTR-8/SVneo cells Normal Homo sapiens CVCL_7162
In Vivo Model
Pregnant rats were randomly divided into 3 groups on gestational day 13, with 8 in each group: Sham group, PE group, and PE + ferrostatin-1 (FI) group. As previously mentioned, on gestational day 14, rats in the PE and PE + FI groups were subjected to reduced uterine perfusion pressure (RUPP) surgery to establish the PE model. Briefly, pregnant rats were anesthetized, sterilized with iodophor, and then opened. A contractile silver clip (0.203 mm) was placed on the aorta above the iliac bifurcation, as well as the bilateral uterine arcades at the end of the ovary were reduced with restrictive clips (0.100 mm) to the ovarian collaterals of the uterus. The rats in the Sham group were operated in a manner similar to the RUPP rats but were not clipped. On a gestational day 14, the mini-pumps were also inserted into the rat's peritoneum. The mini-pump in each rat of the PE + FI group was used to deliver FI at a dose of 10 mol/kg/d for 5 d. Systolic and diastolic blood pressure (SBP and DBP) were measured on gestational days 14, 16, and 19 using catheters inserted into the carotid artery and jugular vein. On a gestational day 19, urine, blood, and placenta of rats were collected for subsequent experiments. Urine protein content was detected using a commercial kit (C035-2, Nanjing Jiancheng, China). Plasma sFlt-1 content was detected by a commercial kit (ml059017, Mlbio, China). The remaining samples were stored at -80 .

    Click to Show/Hide
Response regulation miR-2115-3p might interact with the GOT1 mRNA to downregulate its expression, further inhibiting the hypoxia-promoted ferroptosis in a preeclampsia model.
Preeclampsia [ICD-11: JA24]
In total 1 item(s) under this disease
Experiment 1 Reporting the Ferroptosis-centered Disease Response [1]
Target Regulator hsa-miR-2115-3p (miRNA) miRNA
Pathway Response Ferroptosis hsa04216
Cell Process Cell ferroptosis
In Vitro Model
HTR-8/SVneo cells Normal Homo sapiens CVCL_7162
In Vivo Model
Pregnant rats were randomly divided into 3 groups on gestational day 13, with 8 in each group: Sham group, PE group, and PE + ferrostatin-1 (FI) group. As previously mentioned, on gestational day 14, rats in the PE and PE + FI groups were subjected to reduced uterine perfusion pressure (RUPP) surgery to establish the PE model. Briefly, pregnant rats were anesthetized, sterilized with iodophor, and then opened. A contractile silver clip (0.203 mm) was placed on the aorta above the iliac bifurcation, as well as the bilateral uterine arcades at the end of the ovary were reduced with restrictive clips (0.100 mm) to the ovarian collaterals of the uterus. The rats in the Sham group were operated in a manner similar to the RUPP rats but were not clipped. On a gestational day 14, the mini-pumps were also inserted into the rat's peritoneum. The mini-pump in each rat of the PE + FI group was used to deliver FI at a dose of 10 mol/kg/d for 5 d. Systolic and diastolic blood pressure (SBP and DBP) were measured on gestational days 14, 16, and 19 using catheters inserted into the carotid artery and jugular vein. On a gestational day 19, urine, blood, and placenta of rats were collected for subsequent experiments. Urine protein content was detected using a commercial kit (C035-2, Nanjing Jiancheng, China). Plasma sFlt-1 content was detected by a commercial kit (ml059017, Mlbio, China). The remaining samples were stored at -80 .

    Click to Show/Hide
Response regulation miR-2115-3p might interact with the GOT1 mRNA to downregulate its expression, further inhibiting the hypoxia-promoted ferroptosis in a preeclampsia model.
References
Ref 1 miR-2115-3p inhibits ferroptosis by downregulating the expression of glutamic-oxaloacetic transaminase in preeclampsia. Placenta. 2022 Nov;129:94-103. doi: 10.1016/j.placenta.2022.09.014. Epub 2022 Oct 10.