General Information of the Ferroptosis Regulator (ID: REG20052)
Regulator Name hsa-miR-744-5p (miRNA)
Synonyms
hsa-miR-744-5p
    Click to Show/Hide
Gene Name hsa-miR-744-5p
Regulator Type miRNA
MiRBase ID MIMAT0004945
Sequence
UGCGGGGCUAGGGCUAACAGCA

    Click to Show/Hide
Full List of the Ferroptosis Target of This Regulator and Corresponding Disease/Drug Response(s)
hsa-miR-744-5p can regulate the following target(s), and cause disease/drug response(s). You can browse detail information of target(s) or disease/drug response(s).
Browse Target
Browse Disease
Browse Drug
Phospholipid hydroperoxide glutathione peroxidase (GPX4) [Suppressor]
In total 1 item(s) under this target
Experiment 1 Reporting the Ferroptosis Target of This Regulator [1]
Target for Ferroptosis Suppressor
Responsed Disease Lung cancer ICD-11: 2C25
Responsed Drug Propofol Investigative
Pathway Response Ferroptosis hsa04216
Cell Process Cell ferroptosis
In Vitro Model
A-549 cells Lung adenocarcinoma Homo sapiens CVCL_0023
NCI-H1299 cells Lung large cell carcinoma Homo sapiens CVCL_0060
In Vivo Model
BALB/c nude mice (5 weeks) were provided by Beijing Vital River Laboratory Animal Technology Co., Ltd. (license no: SYXK (Beijing) 20170033). For tumor formation, 8 x 106 A549/Cis cells were subcutaneously injected into the right axilla of each mouse. On the 7th d, Cis (4.0 mg/kg) was intraperitoneally injected into each mouse every 4 days. Then, mice were allocated into 3 groups: Control group (no additional injection); SO group (intraperitoneal injection of soybean oil); and Propofol group [intraperitoneal injection of soybean oil-dissolved propofol (35 mg/kg)]. The volume of the tumor was measured by a caliper every 7 days. Tumor volume was measured according to the formula: V (mm3) = 1/2 ab2 (a: the longest axis of tumor; b: the shortest axis of tumor). Then 35 d after transplantation, mice were euthanatized to measure tumor weight using an electronic balance. A part of transplanted tumors was immediately conserved at liquid nitrogen and -80 . The rest was used for paraffin-embedding and immunohistochemical staining.

    Click to Show/Hide
Response regulation In summary, propofol inhibited GPX4-mediated ferroptosis and reduces CR of non-small cell lung cancer (NSCLC) cells to Cis through the miR-744-5p/miR-615-3p axis.
Lung cancer [ICD-11: 2C25]
In total 1 item(s) under this disease
Experiment 1 Reporting the Ferroptosis-centered Disease Response [1]
Target Regulator hsa-miR-744-5p (miRNA) miRNA
Responsed Drug Propofol Investigative
Pathway Response Ferroptosis hsa04216
Cell Process Cell ferroptosis
In Vitro Model
A-549 cells Lung adenocarcinoma Homo sapiens CVCL_0023
NCI-H1299 cells Lung large cell carcinoma Homo sapiens CVCL_0060
In Vivo Model
BALB/c nude mice (5 weeks) were provided by Beijing Vital River Laboratory Animal Technology Co., Ltd. (license no: SYXK (Beijing) 20170033). For tumor formation, 8 x 106 A549/Cis cells were subcutaneously injected into the right axilla of each mouse. On the 7th d, Cis (4.0 mg/kg) was intraperitoneally injected into each mouse every 4 days. Then, mice were allocated into 3 groups: Control group (no additional injection); SO group (intraperitoneal injection of soybean oil); and Propofol group [intraperitoneal injection of soybean oil-dissolved propofol (35 mg/kg)]. The volume of the tumor was measured by a caliper every 7 days. Tumor volume was measured according to the formula: V (mm3) = 1/2 ab2 (a: the longest axis of tumor; b: the shortest axis of tumor). Then 35 d after transplantation, mice were euthanatized to measure tumor weight using an electronic balance. A part of transplanted tumors was immediately conserved at liquid nitrogen and -80 . The rest was used for paraffin-embedding and immunohistochemical staining.

    Click to Show/Hide
Response regulation In summary, propofol inhibited GPX4-mediated ferroptosis and reduces CR of non-small cell lung cancer (NSCLC) cells to Cis through the miR-744-5p/miR-615-3p axis.
Propofol [Investigative]
In total 1 item(s) under this drug
Experiment 1 Reporting the Ferroptosis-centered Drug Response [1]
Drug for Ferroptosis Inducer
Response Target Phospholipid hydroperoxide glutathione peroxidase (GPX4) Suppressor
Responsed Disease Lung cancer ICD-11: 2C25
Pathway Response Ferroptosis hsa04216
Cell Process Cell ferroptosis
In Vitro Model
A-549 cells Lung adenocarcinoma Homo sapiens CVCL_0023
NCI-H1299 cells Lung large cell carcinoma Homo sapiens CVCL_0060
In Vivo Model
BALB/c nude mice (5 weeks) were provided by Beijing Vital River Laboratory Animal Technology Co., Ltd. (license no: SYXK (Beijing) 20170033). For tumor formation, 8 x 106 A549/Cis cells were subcutaneously injected into the right axilla of each mouse. On the 7th d, Cis (4.0 mg/kg) was intraperitoneally injected into each mouse every 4 days. Then, mice were allocated into 3 groups: Control group (no additional injection); SO group (intraperitoneal injection of soybean oil); and Propofol group [intraperitoneal injection of soybean oil-dissolved propofol (35 mg/kg)]. The volume of the tumor was measured by a caliper every 7 days. Tumor volume was measured according to the formula: V (mm3) = 1/2 ab2 (a: the longest axis of tumor; b: the shortest axis of tumor). Then 35 d after transplantation, mice were euthanatized to measure tumor weight using an electronic balance. A part of transplanted tumors was immediately conserved at liquid nitrogen and -80 . The rest was used for paraffin-embedding and immunohistochemical staining.

    Click to Show/Hide
Response regulation In summary, propofol inhibited GPX4-mediated ferroptosis and reduces CR of non-small cell lung cancer (NSCLC) cells to Cis through the miR-744-5p/miR-615-3p axis.
References
Ref 1 Propofol decreases cisplatin resistance of non-small cell lung cancer by inducing GPX4-mediated ferroptosis through the miR-744-5p/miR-615-3p axis. J Proteomics. 2023 Mar 15;274:104777. doi: 10.1016/j.jprot.2022.104777. Epub 2022 Nov 22.