Ferroptosis Regulator Information

General Information of the Ferroptosis Regulator (ID: REG20048)
Regulator Name hsa-miR-34c-3p (miRNA)
Synonyms
hsa-miR-34c-3p
    Click to Show/Hide
Gene Name hsa-miR-34c-3p
Regulator Type miRNA
MiRBase ID MIMAT0004677
Sequence
AAUCACUAACCACACGGCCAGG

    Click to Show/Hide
Full List of the Ferroptosis Target of This Regulator and Corresponding Disease/Drug Response(s)
hsa-miR-34c-3p can regulate the following target(s), and cause disease/drug response(s). You can browse detail information of target(s) or disease/drug response(s).
Browse Target
Browse Disease
Cystine/glutamate transporter (SLC7A11) [Driver; Suppressor]
 Target Info 
In total 1 item(s) under this target
Experiment 1 Reporting the Ferroptosis Target of This Regulator [1]
Target for Ferroptosis Suppressor
Responsed Disease Oral squamous cell carcinoma ICD-11: 2B6E
 Disease Info 
Pathway Response Fatty acid metabolism hsa01212
Ferroptosis hsa04216
Cell Process Cell ferroptosis
Cell proliferation
In Vitro Model
 SCC-25 cells Squamous carcinoma Homo sapiens CVCL_1682
CAL-27 cells Tongue adenosquamous carcinom Homo sapiens CVCL_1107
HOK cells Normal Hexagrammos otakii CVCL_YE19
Response regulation Low expression of miR-34c-3p in oral squamous cell carcinoma, negatively regulating SLC7A11 expression, promoting ferroptosis, and suppressing cell proliferation.
Oral squamous cell carcinoma [ICD-11: 2B6E]
 Disease Info 
In total 1 item(s) under this disease
Experiment 1 Reporting the Ferroptosis-centered Disease Response [1]
Target Regulator hsa-miR-34c-3p (miRNA) miRNA
 Regulator Info 
Pathway Response Fatty acid metabolism hsa01212
Ferroptosis hsa04216
Cell Process Cell ferroptosis
Cell proliferation
In Vitro Model
 SCC-25 cells Squamous carcinoma Homo sapiens CVCL_1682
CAL-27 cells Tongue adenosquamous carcinom Homo sapiens CVCL_1107
HOK cells Normal Hexagrammos otakii CVCL_YE19
Response regulation Low expression of miR-34c-3p in oral squamous cell carcinoma, negatively regulating SLC7A11 expression, promoting ferroptosis, and suppressing cell proliferation.
References
Ref 1 MiR-34c-3p upregulates erastin-induced ferroptosis to inhibit proliferation in oral squamous cell carcinomas by targeting SLC7A11. Pathol Res Pract. 2022 Mar;231:153778. doi: 10.1016/j.prp.2022.153778. Epub 2022 Jan 25.