Ferroptosis Regulator Information

General Information of the Ferroptosis Regulator (ID: REG20040)
Regulator Name hsa-miR-424-5p (miRNA)
Synonyms
hsa-miR-424-5p
    Click to Show/Hide
Gene Name hsa-miR-424-5p
Regulator Type miRNA
MiRBase ID MIMAT0001341
Sequence
CAGCAGCAAUUCAUGUUUUGAA

    Click to Show/Hide
Full List of the Ferroptosis Target of This Regulator and Corresponding Disease/Drug Response(s)
hsa-miR-424-5p can regulate the following target(s), and cause disease/drug response(s). You can browse detail information of target(s) or disease/drug response(s).
Browse Target
Browse Disease
Long-chain-fatty-acid--CoA ligase 4 (ACSL4) [Driver]
 Target Info 
In total 1 item(s) under this target
Experiment 1 Reporting the Ferroptosis Target of This Regulator [1]
Target for Ferroptosis Driver
Responsed Disease Ovarian cancer ICD-11: 2C73
 Disease Info 
Pathway Response Fatty acid metabolism hsa01212
Ferroptosis hsa04216
Cell Process Cell ferroptosis
In Vitro Model
 HO8910 cells Endocervical adenocarcinoma Homo sapiens CVCL_6868
SK-OV-3 cells Ovarian serous cystadenocarcinoma Homo sapiens CVCL_0532
Response regulation MiR-424-5p negatively regulates ferroptosis by directly targeting ACSL4 in ovarian cancer cells. Upregulation of miR-424-5p suppressed ACSL4 by directly binding to its 3'-UTR, which subsequently reduced erastin- and RSL3-induced ferroptosis.
Ovarian cancer [ICD-11: 2C73]
 Disease Info 
In total 1 item(s) under this disease
Experiment 1 Reporting the Ferroptosis-centered Disease Response [1]
Target Regulator hsa-miR-424-5p (miRNA) miRNA
 Regulator Info 
Pathway Response Fatty acid metabolism hsa01212
Ferroptosis hsa04216
Cell Process Cell ferroptosis
In Vitro Model
 HO8910 cells Endocervical adenocarcinoma Homo sapiens CVCL_6868
SK-OV-3 cells Ovarian serous cystadenocarcinoma Homo sapiens CVCL_0532
Response regulation MiR-424-5p negatively regulates ferroptosis by directly targeting ACSL4 in ovarian cancer cells. Upregulation of miR-424-5p suppressed ACSL4 by directly binding to its 3'-UTR, which subsequently reduced erastin- and RSL3-induced ferroptosis.
References
Ref 1 Tumor suppressor miR-424-5p abrogates ferroptosis in ovarian cancer through targeting ACSL4. Neoplasma. 2021 Jan;68(1):165-173. doi: 10.4149/neo_2020_200707N705. Epub 2020 Oct 7.