General Information of the Ferroptosis Regulator (ID: REG20036)
Regulator Name hsa-miR-378a-3p (miRNA)
Synonyms
hsa-miR-378a-3p
    Click to Show/Hide
Gene Name hsa-miR-378a-3p
Regulator Type miRNA
MiRBase ID MIMAT0000732
Sequence
ACUGGACUUGGAGUCAGAAGGC

    Click to Show/Hide
Full List of the Ferroptosis Target of This Regulator and Corresponding Disease/Drug Response(s)
hsa-miR-378a-3p can regulate the following target(s), and cause disease/drug response(s). You can browse detail information of target(s) or disease/drug response(s).
Browse Target
Browse Disease
Cystine/glutamate transporter (SLC7A11) [Driver; Suppressor]
In total 1 item(s) under this target
Experiment 1 Reporting the Ferroptosis Target of This Regulator [1]
Target for Ferroptosis Suppressor
Responsed Disease Nerve injury ICD-11: NA04
Pathway Response Glutathione metabolism hsa00480
Ferroptosis hsa04216
Cell Process Cell ferroptosis
In Vitro Model
HT22 cells Normal Mus musculus CVCL_0321
In Vivo Model
All the animals were housed in a temperature- and humidity-controlled room under a 12 h light/dark cycle and maintained in standard cages with free access to food and water. After seven days of breeding, the mice were randomly assigned to four groups of fifteen animals each. The animals in the four groups were treated with Pb acetate indrinking waterat doses of 0, 250 mg/L, 500 mg/L, and 1000 mg/L (control, LPb, MPb, and HPb groups, respectively). The Pb exposure period was 12 weeks.

    Click to Show/Hide
Response regulation Inhibition of miR-378a-3p expression reversed the reduction in GSH and the increase in lipid ROS levels induced by lead exposure. MiR-378a-3p exerted an important effect by regulating SLC7A11 expression in nerve injury induced by lead exposure.
Nerve injury [ICD-11: NA04]
In total 1 item(s) under this disease
Experiment 1 Reporting the Ferroptosis-centered Disease Response [1]
Target Regulator hsa-miR-378a-3p (miRNA) miRNA
Pathway Response Glutathione metabolism hsa00480
Ferroptosis hsa04216
Cell Process Cell ferroptosis
In Vitro Model
HT22 cells Normal Mus musculus CVCL_0321
In Vivo Model
All the animals were housed in a temperature- and humidity-controlled room under a 12 h light/dark cycle and maintained in standard cages with free access to food and water. After seven days of breeding, the mice were randomly assigned to four groups of fifteen animals each. The animals in the four groups were treated with Pb acetate indrinking waterat doses of 0, 250 mg/L, 500 mg/L, and 1000 mg/L (control, LPb, MPb, and HPb groups, respectively). The Pb exposure period was 12 weeks.

    Click to Show/Hide
Response regulation Inhibition of miR-378a-3p expression reversed the reduction in GSH and the increase in lipid ROS levels induced by lead exposure. MiR-378a-3p exerted an important effect by regulating SLC7A11 expression in nerve injury induced by lead exposure.
References
Ref 1 MiR-378a-3p/ SLC7A11 regulate ferroptosis in nerve injury induced by lead exposure. Ecotoxicol Environ Saf. 2022 Jul 1;239:113639. doi: 10.1016/j.ecoenv.2022.113639. Epub 2022 May 16.