Ferroptosis Regulator Information

General Information of the Ferroptosis Regulator (ID: REG20027)

Regulator Name	hsa-miR-144-3p (miRNA)
Synonyms	hsa-miR-144-3p Click to Show/Hide
Gene Name	hsa-miR-144-3p
Regulator Type	miRNA
MiRBase ID	MIMAT0000436
Sequence	UACAGUAUAGAUGAUGUACU Click to Show/Hide

Full List of the Ferroptosis Target of This Regulator and Corresponding Disease/Drug Response(s)

hsa-miR-144-3p can regulate the following target(s), and cause disease/drug response(s). You can browse detail information of target(s) or disease/drug response(s).

Browse Target

Browse Disease

Browse Drug

Long-chain-fatty-acid--CoA ligase 4 (ACSL4) [Driver]

Target Info

In total 2 item(s) under this target
Experiment 1 Reporting the Ferroptosis Target of This Regulator				[1]
Target for Ferroptosis	Driver
Responsed Disease	Colorectal cancer		ICD-11: 2B91	Disease Info
Responsed Drug	Bromelain		Investigative	Drug Info
Pathway Response	Fatty acid metabolism			hsa01212
	Ferroptosis			hsa04216
Cell Process	Cell ferroptosis
	Cell proliferation
In Vitro Model	NCI-H508 cells	Cecum adenocarcinoma	Homo sapiens	CVCL_1564
	HCT 116 cells	Colon carcinoma	Homo sapiens	CVCL_0291
	G13D (Human colorectal cancer cells)
	DLD-1 cells	Colon adenocarcinoma	Homo sapiens	CVCL_0248
	G12D (Human colorectal cancer cells)
	CCD-18Co cells	Normal	Homo sapiens	CVCL_2379
In Vivo Model	Animals (n = 7) were given 2.5% DSS in drinking water for 5 days and then no treatment for 14 days as one cycle; this process was repeated for three cycles. In the last cycle, 2% DSS water treated to each group and no treatment for 14 days. During the three DSS cycle, 3 mg/kg bromelain were injected daily intraperitoneally and colon and spleen tissues were harvested after three DSS cycle in 57 days to study polyp burden and to perform histological staining. Click to Show/Hide
Response regulation	Elevated miR-19b-3p, -130a-3p, -150-5p, -144-3p, -16-5p, -7a-5p, and -17-5p in bromelain-treated CaCO2cells compared to in DLD-1 cells potentially targeted ACSL-4 and resulted in suppression of ACSL-4. Overall, bromelain inhibits proliferation of Kras mutant Colorectal Cancer (CRC) effectively via ACSL-4.
Experiment 2 Reporting the Ferroptosis Target of This Regulator				[2]
Target for Ferroptosis	Driver
Responsed Disease	Osteosarcoma		ICD-11: 2B51	Disease Info
Pathway Response	Fatty acid metabolism			hsa01212
	Ferroptosis			hsa04216
Cell Process	Cell ferroptosis
	Cell proliferation
	Cell migration
	Cell invasion
In Vitro Model	143B cells	Osteosarcoma	Homo sapiens	CVCL_2270
	SW1353 cells	Bone chondrosarcoma	Homo sapiens	CVCL_0543
	MG-63 cells	Osteosarcoma	Homo sapiens	CVCL_0426
	SAOS-2 cells	Osteosarcoma	Homo sapiens	CVCL_0548
	U2OS cells	Osteosarcoma	Homo sapiens	CVCL_0042
	HOB (Human normal osteoblastic cells)
In Vivo Model	The OS model of nude mice was constructed using the CDTX model. After transfection, the h143B cells were prepared into a single-cell suspension and subcutaneously injected into the left proximal tibia of 36 (3 mice per group) 4-weeks-old nude mice (1 x 10⁷ cells per mouse). Click to Show/Hide
Response regulation	MiR-144-3p can induce the occurrence of ferroptosis by negatively regulating the expression of ZEB1, thereby inhibiting the proliferation, migration, and invasion of osteosarcoma (OS) cells. The overexpression of ZEB1 caused the lower expression level of ACSL4 and higher expression level of xCT and GPX4.

Phospholipid hydroperoxide glutathione peroxidase (GPX4) [Suppressor]

Target Info

In total 1 item(s) under this target
Experiment 1 Reporting the Ferroptosis Target of This Regulator				[2]
Target for Ferroptosis	Suppressor
Responsed Disease	Osteosarcoma		ICD-11: 2B51	Disease Info
Pathway Response	Fatty acid metabolism			hsa01212
	Ferroptosis			hsa04216
Cell Process	Cell ferroptosis
	Cell proliferation
	Cell migration
	Cell invasion
In Vitro Model	143B cells	Osteosarcoma	Homo sapiens	CVCL_2270
	SW1353 cells	Bone chondrosarcoma	Homo sapiens	CVCL_0543
	MG-63 cells	Osteosarcoma	Homo sapiens	CVCL_0426
	SAOS-2 cells	Osteosarcoma	Homo sapiens	CVCL_0548
	U2OS cells	Osteosarcoma	Homo sapiens	CVCL_0042
	HOB (Human normal osteoblastic cells)
In Vivo Model	The OS model of nude mice was constructed using the CDTX model. After transfection, the h143B cells were prepared into a single-cell suspension and subcutaneously injected into the left proximal tibia of 36 (3 mice per group) 4-weeks-old nude mice (1 x 10⁷ cells per mouse). Click to Show/Hide
Response regulation	MiR-144-3p can induce the occurrence of ferroptosis by negatively regulating the expression of ZEB1, thereby inhibiting the proliferation, migration, and invasion of osteosarcoma (OS) cells. The overexpression of ZEB1 caused the lower expression level of ACSL4 and higher expression level of xCT and GPX4.

Colorectal cancer [ICD-11: 2B91]

Disease Info

In total 1 item(s) under this disease
Experiment 1 Reporting the Ferroptosis-centered Disease Response				[1]
Target Regulator	hsa-miR-144-3p (miRNA)		miRNA	Regulator Info
Responsed Drug	Bromelain		Investigative	Drug Info
Pathway Response	Fatty acid metabolism			hsa01212
	Ferroptosis			hsa04216
Cell Process	Cell ferroptosis
	Cell proliferation
In Vitro Model	NCI-H508 cells	Cecum adenocarcinoma	Homo sapiens	CVCL_1564
	HCT 116 cells	Colon carcinoma	Homo sapiens	CVCL_0291
	G13D (Human colorectal cancer cells)
	DLD-1 cells	Colon adenocarcinoma	Homo sapiens	CVCL_0248
	G12D (Human colorectal cancer cells)
	CCD-18Co cells	Normal	Homo sapiens	CVCL_2379
In Vivo Model	Animals (n = 7) were given 2.5% DSS in drinking water for 5 days and then no treatment for 14 days as one cycle; this process was repeated for three cycles. In the last cycle, 2% DSS water treated to each group and no treatment for 14 days. During the three DSS cycle, 3 mg/kg bromelain were injected daily intraperitoneally and colon and spleen tissues were harvested after three DSS cycle in 57 days to study polyp burden and to perform histological staining. Click to Show/Hide
Response regulation	Elevated miR-19b-3p, -130a-3p, -150-5p, -144-3p, -16-5p, -7a-5p, and -17-5p in bromelain-treated CaCO2cells compared to in DLD-1 cells potentially targeted ACSL-4 and resulted in suppression of ACSL-4. Overall, bromelain inhibits proliferation of Kras mutant Colorectal Cancer (CRC) effectively via ACSL-4.

Osteosarcoma [ICD-11: 2B51]

Disease Info

In total 2 item(s) under this disease
Experiment 1 Reporting the Ferroptosis-centered Disease Response				[2]
Target Regulator	hsa-miR-144-3p (miRNA)		miRNA	Regulator Info
Pathway Response	Fatty acid metabolism			hsa01212
	Ferroptosis			hsa04216
Cell Process	Cell ferroptosis
	Cell proliferation
	Cell migration
	Cell invasion
In Vitro Model	143B cells	Osteosarcoma	Homo sapiens	CVCL_2270
	SW1353 cells	Bone chondrosarcoma	Homo sapiens	CVCL_0543
	MG-63 cells	Osteosarcoma	Homo sapiens	CVCL_0426
	SAOS-2 cells	Osteosarcoma	Homo sapiens	CVCL_0548
	U2OS cells	Osteosarcoma	Homo sapiens	CVCL_0042
	HOB (Human normal osteoblastic cells)
In Vivo Model	The OS model of nude mice was constructed using the CDTX model. After transfection, the h143B cells were prepared into a single-cell suspension and subcutaneously injected into the left proximal tibia of 36 (3 mice per group) 4-weeks-old nude mice (1 x 10⁷ cells per mouse). Click to Show/Hide
Response regulation	MiR-144-3p can induce the occurrence of ferroptosis by negatively regulating the expression of ZEB1, thereby inhibiting the proliferation, migration, and invasion of osteosarcoma (OS) cells. The overexpression of ZEB1 caused the lower expression level of ACSL4 and higher expression level of xCT and GPX4.
Experiment 2 Reporting the Ferroptosis-centered Disease Response				[2]
Target Regulator	hsa-miR-144-3p (miRNA)		miRNA	Regulator Info
Pathway Response	Fatty acid metabolism			hsa01212
	Ferroptosis			hsa04216
Cell Process	Cell ferroptosis
	Cell proliferation
	Cell migration
	Cell invasion
In Vitro Model	143B cells	Osteosarcoma	Homo sapiens	CVCL_2270
	SW1353 cells	Bone chondrosarcoma	Homo sapiens	CVCL_0543
	MG-63 cells	Osteosarcoma	Homo sapiens	CVCL_0426
	SAOS-2 cells	Osteosarcoma	Homo sapiens	CVCL_0548
	U2OS cells	Osteosarcoma	Homo sapiens	CVCL_0042
	HOB (Human normal osteoblastic cells)
In Vivo Model	The OS model of nude mice was constructed using the CDTX model. After transfection, the h143B cells were prepared into a single-cell suspension and subcutaneously injected into the left proximal tibia of 36 (3 mice per group) 4-weeks-old nude mice (1 x 10⁷ cells per mouse). Click to Show/Hide
Response regulation	MiR-144-3p can induce the occurrence of ferroptosis by negatively regulating the expression of ZEB1, thereby inhibiting the proliferation, migration, and invasion of osteosarcoma (OS) cells. The overexpression of ZEB1 caused the lower expression level of ACSL4 and higher expression level of xCT and GPX4.

Bromelain [Investigative]

Drug Info

In total 1 item(s) under this drug
Experiment 1 Reporting the Ferroptosis-centered Drug Response				[1]
Drug for Ferroptosis	Inducer
Response Target	Long-chain-fatty-acid--CoA ligase 4 (ACSL4)		Driver	Target Info
Responsed Disease	Colorectal cancer		ICD-11: 2B91	Disease Info
Pathway Response	Fatty acid metabolism			hsa01212
	Ferroptosis			hsa04216
Cell Process	Cell ferroptosis
	Cell proliferation
In Vitro Model	NCI-H508 cells	Cecum adenocarcinoma	Homo sapiens	CVCL_1564
	HCT 116 cells	Colon carcinoma	Homo sapiens	CVCL_0291
	G13D (Human colorectal cancer cells)
	DLD-1 cells	Colon adenocarcinoma	Homo sapiens	CVCL_0248
	G12D (Human colorectal cancer cells)
	CCD-18Co cells	Normal	Homo sapiens	CVCL_2379
In Vivo Model	Animals (n = 7) were given 2.5% DSS in drinking water for 5 days and then no treatment for 14 days as one cycle; this process was repeated for three cycles. In the last cycle, 2% DSS water treated to each group and no treatment for 14 days. During the three DSS cycle, 3 mg/kg bromelain were injected daily intraperitoneally and colon and spleen tissues were harvested after three DSS cycle in 57 days to study polyp burden and to perform histological staining. Click to Show/Hide
Response regulation	Elevated miR-19b-3p, -130a-3p, -150-5p, -144-3p, -16-5p, -7a-5p, and -17-5p in bromelain-treated CaCO2cells compared to in DLD-1 cells potentially targeted ACSL-4 and resulted in suppression of ACSL-4. Overall, bromelain inhibits proliferation of Kras mutant Colorectal Cancer (CRC) effectively via ACSL-4.

References

Ref 1	Bromelain effectively suppresses Kras-mutant colorectal cancer by stimulating ferroptosis. Anim Cells Syst (Seoul). 2018 Aug 30;22(5):334-340. doi: 10.1080/19768354.2018.1512521. eCollection 2018.
Ref 2	Exosome-mediated miR-144-3p promotes ferroptosis to inhibit osteosarcoma proliferation, migration, and invasion through regulating ZEB1. Mol Cancer. 2023 Jul 17;22(1):113. doi: 10.1186/s12943-023-01804-z.

Ferroptosis Regulator Information

About FERREG

Visitor Map

Correspondence

Prof. Shuiping Liu