Ferroptosis Regulator Information

General Information of the Ferroptosis Regulator (ID: REG20024)
Regulator Name hsa-miR-138-5p (miRNA)
Synonyms
hsa-miR-138-5p
    Click to Show/Hide
Gene Name hsa-miR-138-5p
Regulator Type miRNA
MiRBase ID MIMAT0000430
Sequence
AGCUGGUGUUGUGAAUCAGGCCG

    Click to Show/Hide
Full List of the Ferroptosis Target of This Regulator and Corresponding Disease/Drug Response(s)
hsa-miR-138-5p can regulate the following target(s), and cause disease/drug response(s). You can browse detail information of target(s) or disease/drug response(s).
Browse Target
Browse Disease
Browse Drug
Nuclear factor erythroid 2-related factor 2 (NFE2L2) [Suppressor; Marker]
 Target Info 
In total 1 item(s) under this target
Experiment 1 Reporting the Ferroptosis Target of This Regulator [1]
Target for Ferroptosis Marker/Suppressor
Responsed Disease Retinopathy ICD-11: 9B71
 Disease Info 
Responsed Drug Astragaloside IV Investigative
 Drug Info 
Pathway Response Fatty acid metabolism hsa01212
Cell Process Cell ferroptosis
In Vitro Model
 ARPE-19 cells Normal Homo sapiens CVCL_0145
Response regulation Astragaloside IV (AS-IV) inhibited miR-138-5p expression, subsequently increasing Sirt1/Nrf2 activity and cellular antioxidant capacity to alleviate ferroptosis, resulting decreased cell death, which potentially inhibits the diabetic retinopathy pathological process.
Retinopathy [ICD-11: 9B71]
 Disease Info 
In total 1 item(s) under this disease
Experiment 1 Reporting the Ferroptosis-centered Disease Response [1]
Target Regulator hsa-miR-138-5p (miRNA) miRNA
 Regulator Info 
Responsed Drug Astragaloside IV Investigative
 Drug Info 
Pathway Response Fatty acid metabolism hsa01212
Cell Process Cell ferroptosis
In Vitro Model
 ARPE-19 cells Normal Homo sapiens CVCL_0145
Response regulation Astragaloside IV (AS-IV) inhibited miR-138-5p expression, subsequently increasing Sirt1/Nrf2 activity and cellular antioxidant capacity to alleviate ferroptosis, resulting decreased cell death, which potentially inhibits the diabetic retinopathy pathological process.
Astragaloside IV [Investigative]
 Drug Info 
In total 1 item(s) under this drug
Experiment 1 Reporting the Ferroptosis-centered Drug Response [1]
Drug for Ferroptosis Suppressor
Response Target Nuclear factor erythroid 2-related factor 2 (NFE2L2) Suppressor; Marker
 Target Info 
Responsed Disease Retinopathy ICD-11: 9B71
 Disease Info 
Pathway Response Fatty acid metabolism hsa01212
Cell Process Cell ferroptosis
In Vitro Model
 ARPE-19 cells Normal Homo sapiens CVCL_0145
Response regulation Astragaloside IV (AS-IV) inhibited miR-138-5p expression, subsequently increasing Sirt1/Nrf2 activity and cellular antioxidant capacity to alleviate ferroptosis, resulting decreased cell death, which potentially inhibits the diabetic retinopathy pathological process.
References
Ref 1 Astragaloside-IV alleviates high glucose-induced ferroptosis in retinal pigment epithelial cells by disrupting the expression of miR-138-5p/Sirt1/Nrf2. Bioengineered. 2022 Apr;13(4):8240-8254. doi: 10.1080/21655979.2022.2049471.