Ferroptosis Regulator Information

General Information of the Ferroptosis Regulator (ID: REG20021)
Regulator Name hsa-miR-124-3p (miRNA)
Synonyms
hsa-miR-124-3p
    Click to Show/Hide
Gene Name hsa-miR-124-3p
Regulator Type miRNA
MiRBase ID MIMAT0000422
Sequence
UAAGGCACGCGGUGAAUGCCAA

    Click to Show/Hide
Full List of the Ferroptosis Target of This Regulator and Corresponding Disease/Drug Response(s)
hsa-miR-124-3p can regulate the following target(s), and cause disease/drug response(s). You can browse detail information of target(s) or disease/drug response(s).
Browse Target
Browse Disease
Phospholipid hydroperoxide glutathione peroxidase (GPX4) [Suppressor]
 Target Info 
In total 1 item(s) under this target
Experiment 1 Reporting the Ferroptosis Target of This Regulator [1]
Target for Ferroptosis Suppressor
Responsed Disease Cardiovascular diseases ICD-11: BE2Z
 Disease Info 
Pathway Response Fatty acid metabolism hsa01212
Cell Process Cell ferroptosis
In Vitro Model
 hAAFs (Human aortic adventitial fibroblasts)
Response regulation UII inhibited miR-124 expression through up-regulating circ0004372 expression, thereby promoting SERTAD4 expression. UII significantly promoted the generation of ROS, MDA and 4-HNE, reduced the activities of SOD, GST and GR, increased Fe2+ concentration and inhibited GPX4 expression through circ0004372/ miR-124/SERTAD4 for cardiovascular diseases.
Natural resistance-associated macrophage protein 2 (SLC11A2) [Driver]
 Target Info 
In total 1 item(s) under this target
Experiment 1 Reporting the Ferroptosis Target of This Regulator [2]
Target for Ferroptosis Driver
Responsed Disease Ischemia/reperfusion injury ICD-11: DB98
 Disease Info 
Pathway Response Fatty acid metabolism hsa01212
Ferroptosis hsa04216
Cell Process Cell ferroptosis
In Vitro Model
 rBMMSCs (Rat bone marrow mesenchymal stem cells)
IAR 20 cells Normal Homo sapiens CVCL_5296
Response regulation MiR-124-3p in HM-exos downregulates Steap3 expression to inhibit ferroptosis, thereby attenuating graft ischemia reperfusion injury. And HUCB-MSCs-exos inhibited the expression of DMT1 by delivering miR-23a-3p, which suppressed cardiomyocyte ferroptosis after myocardial infarction.
Lysophospholipid acyltransferase 5 (LPCAT3) [Driver]
 Target Info 
In total 1 item(s) under this target
Experiment 1 Reporting the Ferroptosis Target of This Regulator [3]
Target for Ferroptosis Driver
Responsed Disease Sepsis ICD-11: 1G40
 Disease Info 
Pathway Response Fatty acid metabolism hsa01212
Ferroptosis hsa04216
Cell Process Cell ferroptosis
Cell proliferation
In Vitro Model
 HK-2 cells Normal Homo sapiens CVCL_0302
Response regulation MiR-124-3p can regulate LPCAT3 expression and affect lipid metabolism, which leads to ferroptosis. These results could provide the scientific basis for early diagnosis and renal replacement therapy in sepsis-associated acute renal injury.
Sepsis [ICD-11: 1G40]
 Disease Info 
In total 1 item(s) under this disease
Experiment 1 Reporting the Ferroptosis-centered Disease Response [3]
Target Regulator hsa-miR-124-3p (miRNA) miRNA
 Regulator Info 
Pathway Response Fatty acid metabolism hsa01212
Ferroptosis hsa04216
Cell Process Cell ferroptosis
Cell proliferation
In Vitro Model
 HK-2 cells Normal Homo sapiens CVCL_0302
Response regulation MiR-124-3p can regulate LPCAT3 expression and affect lipid metabolism, which leads to ferroptosis. These results could provide the scientific basis for early diagnosis and renal replacement therapy in sepsis-associated acute renal injury.
Cardiovascular diseases [ICD-11: BE2Z]
 Disease Info 
In total 1 item(s) under this disease
Experiment 1 Reporting the Ferroptosis-centered Disease Response [1]
Target Regulator hsa-miR-124-3p (miRNA) miRNA
 Regulator Info 
Pathway Response Fatty acid metabolism hsa01212
Cell Process Cell ferroptosis
In Vitro Model
 hAAFs (Human aortic adventitial fibroblasts)
Response regulation UII inhibited miR-124 expression through up-regulating circ0004372 expression, thereby promoting SERTAD4 expression. UII significantly promoted the generation of ROS, MDA and 4-HNE, reduced the activities of SOD, GST and GR, increased Fe2+ concentration and inhibited GPX4 expression through circ0004372/ miR-124/SERTAD4 for cardiovascular diseases.
Ischemia/reperfusion injury [ICD-11: DB98]
 Disease Info 
In total 1 item(s) under this disease
Experiment 1 Reporting the Ferroptosis-centered Disease Response [2]
Target Regulator hsa-miR-124-3p (miRNA) miRNA
 Regulator Info 
Pathway Response Fatty acid metabolism hsa01212
Ferroptosis hsa04216
Cell Process Cell ferroptosis
In Vitro Model
 rBMMSCs (Rat bone marrow mesenchymal stem cells)
IAR 20 cells Normal Homo sapiens CVCL_5296
Response regulation MiR-124-3p in HM-exos downregulates Steap3 expression to inhibit ferroptosis, thereby attenuating graft ischemia reperfusion injury. And HUCB-MSCs-exos inhibited the expression of DMT1 by delivering miR-23a-3p, which suppressed cardiomyocyte ferroptosis after myocardial infarction.
References
Ref 1 Urotensin II activates the ferroptosis pathway through circ0004372/miR-124/SERTAD4 to promote the activation of vascular adventitial fibroblasts. Gen Physiol Biophys. 2022 Sep;41(5):381-392. doi: 10.4149/gpb_2022027.
Ref 2 miR-124-3p delivered by exosomes from heme oxygenase-1 modified bone marrow mesenchymal stem cells inhibits ferroptosis to attenuate ischemia-reperfusion injury in steatotic grafts. J Nanobiotechnology. 2022 Apr 22;20(1):196. doi: 10.1186/s12951-022-01407-8.
Ref 3 The regulation of LPCAT3 by miR-124-3p.1 in acute kidney injury suppresses cell proliferation by disrupting phospholipid metabolism. Biochem Biophys Res Commun. 2022 May 14;604:37-42. doi: 10.1016/j.bbrc.2022.03.009. Epub 2022 Mar 9.