Ferroptosis Regulator Information

General Information of the Ferroptosis Regulator (ID: REG20019)
Regulator Name hsa-miR-1-3p (miRNA)
Synonyms
hsa-miR-1-3p
    Click to Show/Hide
Gene Name hsa-miR-1-3p
Regulator Type miRNA
MiRBase ID MIMAT0000416
Sequence
UGGAAUGUAAAGAAGUAUGUAU

    Click to Show/Hide
Full List of the Ferroptosis Target of This Regulator and Corresponding Disease/Drug Response(s)
hsa-miR-1-3p can regulate the following target(s), and cause disease/drug response(s). You can browse detail information of target(s) or disease/drug response(s).
Browse Target
Browse Disease
Phospholipid hydroperoxide glutathione peroxidase (GPX4) [Suppressor]
 Target Info 
In total 1 item(s) under this target
Experiment 1 Reporting the Ferroptosis Target of This Regulator [1]
Target for Ferroptosis Suppressor
Responsed Disease Ovarian cancer ICD-11: 2C73
 Disease Info 
Pathway Response Fatty acid metabolism hsa01212
Ferroptosis hsa04216
Cell Process Cell ferroptosis
In Vitro Model
 HOSE 96-9-98 cells Normal Homo sapiens CVCL_UW70
HO8910 cells Endocervical adenocarcinoma Homo sapiens CVCL_6868
SK-OV-3 cells Ovarian serous cystadenocarcinoma Homo sapiens CVCL_0532
HEK-293T cells Normal Homo sapiens CVCL_0063
Response regulation FZD7 was a direct target of miR-1-3p, which inhibited the expression of FZD7 by binding to the 3'-untranslated region (3'UTR) site of FZD7. In ovarian cancer tissues, overexpression of FZD7 reduced the sensitivity of platinum-resistant ovarian cancer cells to ferroptosis by up-regulating GPX4 expression.
Ovarian cancer [ICD-11: 2C73]
 Disease Info 
In total 1 item(s) under this disease
Experiment 1 Reporting the Ferroptosis-centered Disease Response [1]
Target Regulator hsa-miR-1-3p (miRNA) miRNA
 Regulator Info 
Pathway Response Fatty acid metabolism hsa01212
Ferroptosis hsa04216
Cell Process Cell ferroptosis
In Vitro Model
 HOSE 96-9-98 cells Normal Homo sapiens CVCL_UW70
HO8910 cells Endocervical adenocarcinoma Homo sapiens CVCL_6868
SK-OV-3 cells Ovarian serous cystadenocarcinoma Homo sapiens CVCL_0532
HEK-293T cells Normal Homo sapiens CVCL_0063
Response regulation FZD7 was a direct target of miR-1-3p, which inhibited the expression of FZD7 by binding to the 3'-untranslated region (3'UTR) site of FZD7. In ovarian cancer tissues, overexpression of FZD7 reduced the sensitivity of platinum-resistant ovarian cancer cells to ferroptosis by up-regulating GPX4 expression.
References
Ref 1 MiR-1-3p enhances the sensitivity of ovarian cancer cells to ferroptosis by targeting FZD7. Zhong Nan Da Xue Xue Bao Yi Xue Ban. 2022 Nov 28;47(11):1512-1521. doi: 10.11817/j.issn.1672-7347.2022.210800.