General Information of the Ferroptosis Regulator (ID: REG20018)
Regulator Name hsa-miR-214-3p (miRNA)
Synonyms
hsa-miR-214-3p
    Click to Show/Hide
Gene Name hsa-miR-214-3p
Regulator Type miRNA
MiRBase ID MIMAT0000271
Sequence
ACAGCAGGCACAGACAGGCAGU

    Click to Show/Hide
Full List of the Ferroptosis Target of This Regulator and Corresponding Disease/Drug Response(s)
hsa-miR-214-3p can regulate the following target(s), and cause disease/drug response(s). You can browse detail information of target(s) or disease/drug response(s).
Browse Target
Browse Disease
Browse Drug
Phospholipid hydroperoxide glutathione peroxidase (GPX4) [Suppressor]
In total 1 item(s) under this target
Experiment 1 Reporting the Ferroptosis Target of This Regulator [1]
Target for Ferroptosis Suppressor
Responsed Disease Hepatocellular carcinoma ICD-11: 2C12
Responsed Drug Ketamine Investigative
Pathway Response Fatty acid metabolism hsa01212
Ferroptosis hsa04216
Cell Process Cell ferroptosis
Cell proliferation
In Vitro Model
Hep-G2 cells Hepatoblastoma Homo sapiens CVCL_0027
Huh-7 cells Hepatocellular carcinoma Homo sapiens CVCL_0336
In Vivo Model
BALB/c nude mice (age 6 weeks) were brought from the Laboratory Animal Center of Chinese Academy of Sciences (China). HepG2 cell suspension (100 uL, 5 x 105 per site) was hypodermically inoculated into the fat pad of mice. Tumor volume was calculated as follows: tumor volume (mm3) = 0.5 x width (mm)2 x length (mm). When tumor size reached 100 mm3, mice were treated with ketamine (20 mg/kg) or saline intraperitoneally. The mice were succumbed to death when tumor size reached 1000 mm3. Tumors were isolated and weighted. All animal experiments were carried out in accordance with the National Institutes of Health guide for the care and use of Laboratory animals (NIH Publications No. 8023, revised 1978).

    Click to Show/Hide
Response regulation LncPVT1 directly interacted with miR-214-3p to impede its role as a sponge of GPX4. Depletion of lncPVT1 accelerated the ferroptosis of liver cancer cells, whereas miR-214-3p inhibition and GPX4 overexpression reversed this effect. In this work, we determined that ketamine suppressed viability of liver cancer cells and induced ferroptosis and identified the possible regulatory mechanism of lncPVT1/miR-214-3p/GPX4 axis.
Hepatocellular carcinoma [ICD-11: 2C12]
In total 1 item(s) under this disease
Experiment 1 Reporting the Ferroptosis-centered Disease Response [1]
Target Regulator hsa-miR-214-3p (miRNA) miRNA
Responsed Drug Ketamine Investigative
Pathway Response Fatty acid metabolism hsa01212
Ferroptosis hsa04216
Cell Process Cell ferroptosis
Cell proliferation
In Vitro Model
Hep-G2 cells Hepatoblastoma Homo sapiens CVCL_0027
Huh-7 cells Hepatocellular carcinoma Homo sapiens CVCL_0336
In Vivo Model
BALB/c nude mice (age 6 weeks) were brought from the Laboratory Animal Center of Chinese Academy of Sciences (China). HepG2 cell suspension (100 uL, 5 x 105 per site) was hypodermically inoculated into the fat pad of mice. Tumor volume was calculated as follows: tumor volume (mm3) = 0.5 x width (mm)2 x length (mm). When tumor size reached 100 mm3, mice were treated with ketamine (20 mg/kg) or saline intraperitoneally. The mice were succumbed to death when tumor size reached 1000 mm3. Tumors were isolated and weighted. All animal experiments were carried out in accordance with the National Institutes of Health guide for the care and use of Laboratory animals (NIH Publications No. 8023, revised 1978).

    Click to Show/Hide
Response regulation LncPVT1 directly interacted with miR-214-3p to impede its role as a sponge of GPX4. Depletion of lncPVT1 accelerated the ferroptosis of liver cancer cells, whereas miR-214-3p inhibition and GPX4 overexpression reversed this effect. In this work, we determined that ketamine suppressed viability of liver cancer cells and induced ferroptosis and identified the possible regulatory mechanism of lncPVT1/miR-214-3p/GPX4 axis.
Ketamine [Investigative]
In total 1 item(s) under this drug
Experiment 1 Reporting the Ferroptosis-centered Drug Response [1]
Drug for Ferroptosis Inducer
Response Target Phospholipid hydroperoxide glutathione peroxidase (GPX4) Suppressor
Responsed Disease Hepatocellular carcinoma ICD-11: 2C12
Pathway Response Fatty acid metabolism hsa01212
Ferroptosis hsa04216
Cell Process Cell ferroptosis
Cell proliferation
In Vitro Model
Hep-G2 cells Hepatoblastoma Homo sapiens CVCL_0027
Huh-7 cells Hepatocellular carcinoma Homo sapiens CVCL_0336
In Vivo Model
BALB/c nude mice (age 6 weeks) were brought from the Laboratory Animal Center of Chinese Academy of Sciences (China). HepG2 cell suspension (100 uL, 5 x 105 per site) was hypodermically inoculated into the fat pad of mice. Tumor volume was calculated as follows: tumor volume (mm3) = 0.5 x width (mm)2 x length (mm). When tumor size reached 100 mm3, mice were treated with ketamine (20 mg/kg) or saline intraperitoneally. The mice were succumbed to death when tumor size reached 1000 mm3. Tumors were isolated and weighted. All animal experiments were carried out in accordance with the National Institutes of Health guide for the care and use of Laboratory animals (NIH Publications No. 8023, revised 1978).

    Click to Show/Hide
Response regulation LncPVT1 directly interacted with miR-214-3p to impede its role as a sponge of GPX4. Depletion of lncPVT1 accelerated the ferroptosis of liver cancer cells, whereas miR-214-3p inhibition and GPX4 overexpression reversed this effect. In this work, we determined that ketamine suppressed viability of liver cancer cells and induced ferroptosis and identified the possible regulatory mechanism of lncPVT1/miR-214-3p/GPX4 axis.
References
Ref 1 Ketamine Induces Ferroptosis of Liver Cancer Cells by Targeting lncRNA PVT1/miR-214-3p/GPX4. Drug Des Devel Ther. 2021 Sep 18;15:3965-3978. doi: 10.2147/DDDT.S332847. eCollection 2021.