Ferroptosis Regulator Information

General Information of the Ferroptosis Regulator (ID: REG50015)
Regulator Name hsa-mir-539 (Precursor RNA)
Synonyms
hsa-mir-539
    Click to Show/Hide
Gene Name hsa-mir-539
Regulator Type Precursor RNA
MiRBase ID MI0003514
Sequence
AUACUUGAGGAGAAAUUAUCCUUGGUGUGUUCGCUUUAUUUAUGAUGAAUCAUACAAGGA
CAAUUUCUUUUUGAGUAU

    Click to Show/Hide
Full List of the Ferroptosis Target of This Regulator and Corresponding Disease/Drug Response(s)
hsa-mir-539 can regulate the following target(s), and cause disease/drug response(s). You can browse detail information of target(s) or disease/drug response(s).
Browse Target
Browse Disease
Phospholipid hydroperoxide glutathione peroxidase (GPX4) [Suppressor]
 Target Info 
In total 1 item(s) under this target
Experiment 1 Reporting the Ferroptosis Target of This Regulator [1]
Target for Ferroptosis Suppressor
Responsed Disease Colorectal cancer ICD-11: 2B91
 Disease Info 
Pathway Response Ferroptosis hsa04216
MAPK signaling pathway hsa04010
Fatty acid metabolism hsa01212
Cell Process Cell ferroptosis
Cell proliferation
In Vitro Model
 HCT 116 cells Colon carcinoma Homo sapiens CVCL_0291
SW480 cells Colon adenocarcinoma Homo sapiens CVCL_0546
HEK-293T cells Normal Homo sapiens CVCL_0063
In Vivo Model
Six 4-week-old male BALB/c nude mice were ordered from the Shanghai Laboratory Animal Center (Shanghai SLAC Laboratory Animal Co., Ltd., China). A total of 5 x 106 TIPE+/+ SW480 cells were suspended in 100 uL of PBS and subcutaneously injected into the right axilla flank of each nude mouse, and the same amount of vector SW480 cells was into the left. At 2 weeks after inoculation, the xenograft tumor size was measured using Vernier calipers every 2 days.

    Click to Show/Hide
Response regulation MiR-539 can bind to and regulate the expression of TIPE, and miR-539 activates SAPK/JNK to downregulate the expression of glutathione peroxidase 4 (GPX4) and promote ferroptosis. In addition, SAPK/JNK is the upstream molecule of p53. MiR-539 is a new therapeutic target for colorectal cancer (CRC) patients.
Colorectal cancer [ICD-11: 2B91]
 Disease Info 
In total 1 item(s) under this disease
Experiment 1 Reporting the Ferroptosis-centered Disease Response [1]
Target Regulator hsa-mir-539 (Precursor RNA) Precursor RNA
 Regulator Info 
Pathway Response Ferroptosis hsa04216
MAPK signaling pathway hsa04010
Fatty acid metabolism hsa01212
Cell Process Cell ferroptosis
Cell proliferation
In Vitro Model
 HCT 116 cells Colon carcinoma Homo sapiens CVCL_0291
SW480 cells Colon adenocarcinoma Homo sapiens CVCL_0546
HEK-293T cells Normal Homo sapiens CVCL_0063
In Vivo Model
Six 4-week-old male BALB/c nude mice were ordered from the Shanghai Laboratory Animal Center (Shanghai SLAC Laboratory Animal Co., Ltd., China). A total of 5 x 106 TIPE+/+ SW480 cells were suspended in 100 uL of PBS and subcutaneously injected into the right axilla flank of each nude mouse, and the same amount of vector SW480 cells was into the left. At 2 weeks after inoculation, the xenograft tumor size was measured using Vernier calipers every 2 days.

    Click to Show/Hide
Response regulation MiR-539 can bind to and regulate the expression of TIPE, and miR-539 activates SAPK/JNK to downregulate the expression of glutathione peroxidase 4 (GPX4) and promote ferroptosis. In addition, SAPK/JNK is the upstream molecule of p53. MiR-539 is a new therapeutic target for colorectal cancer (CRC) patients.
References
Ref 1 miR-539 activates the SAPK/JNK signaling pathway to promote ferropotosis in colorectal cancer by directly targeting TIPE. Cell Death Discov. 2021 Oct 2;7(1):272. doi: 10.1038/s41420-021-00659-x.