Ferroptosis Regulator Information

General Information of the Ferroptosis Regulator (ID: REG50008)
Regulator Name hsa-mir-222 (Precursor RNA)
Synonyms
hsa-mir-222
    Click to Show/Hide
Gene Name hsa-mir-222
Regulator Type Precursor RNA
MiRBase ID MI0000299
Sequence
GCUGCUGGAAGGUGUAGGUACCCUCAAUGGCUCAGUAGCCAGUGUAGAUCCUGUCUUUCG
UAAUCAGCAGCUACAUCUGGCUACUGGGUCUCUGAUGGCAUCUUCUAGCU

    Click to Show/Hide
Full List of the Ferroptosis Target of This Regulator and Corresponding Disease/Drug Response(s)
hsa-mir-222 can regulate the following target(s), and cause disease/drug response(s). You can browse detail information of target(s) or disease/drug response(s).
Browse Target
Browse Disease
Transferrin receptor protein 1 (TFRC) [Driver; Suppressor; Marker]
 Target Info 
In total 1 item(s) under this target
Experiment 1 Reporting the Ferroptosis Target of This Regulator [1]
Target for Ferroptosis Marker/Suppressor/Driver
Responsed Disease Liver fibrosis ICD-11: DB93
 Disease Info 
Pathway Response Fatty acid metabolism hsa01212
Ferroptosis hsa04216
Cell Process Cell ferroptosis
Cell proliferation
In Vitro Model
 L-02 cells Endocervical adenocarcinoma Homo sapiens CVCL_6926
In Vivo Model
Male C57BL/6 mice (6-8-weeks old; Vitalriver, Beijing, China) were employed. Briefly, 200 ul AAV8-HBV-1.2 was introduced through the tail vein. The exosomes (10 ug) derived from HBV-infected LO2 cells were dissolved in PBS (50 ul) and introduced through the tail vein 2 h after AAV8-HBV-1.2 injection. Mice were anesthetized by inhalation with 3% isoflurane and sacrificed by cervical dislocation after 4 weeks to collect livers for hematoxylin-eosin (HE) and Masson's Trichrome staining and measurement of liver injury as previously described.

    Click to Show/Hide
Response regulation Exosomes derived from HBV-infected LO2 cells promote LX-2 cell activation and liver fibrosis in mouse Exosomal miR-222 derived from HBV-infected LO2 cells promotes LX-2 cell activation TFRC is a target of miR-222 and inhibits LX-2 cell activation induced by miR-222 miR-222 promotes LX-2 cell activation through inhibiting TFRC-induced ferroptosis.
Liver fibrosis [ICD-11: DB93]
 Disease Info 
In total 1 item(s) under this disease
Experiment 1 Reporting the Ferroptosis-centered Disease Response [1]
Target Regulator hsa-mir-222 (Precursor RNA) Precursor RNA
 Regulator Info 
Pathway Response Fatty acid metabolism hsa01212
Ferroptosis hsa04216
Cell Process Cell ferroptosis
Cell proliferation
In Vitro Model
 L-02 cells Endocervical adenocarcinoma Homo sapiens CVCL_6926
In Vivo Model
Male C57BL/6 mice (6-8-weeks old; Vitalriver, Beijing, China) were employed. Briefly, 200 ul AAV8-HBV-1.2 was introduced through the tail vein. The exosomes (10 ug) derived from HBV-infected LO2 cells were dissolved in PBS (50 ul) and introduced through the tail vein 2 h after AAV8-HBV-1.2 injection. Mice were anesthetized by inhalation with 3% isoflurane and sacrificed by cervical dislocation after 4 weeks to collect livers for hematoxylin-eosin (HE) and Masson's Trichrome staining and measurement of liver injury as previously described.

    Click to Show/Hide
Response regulation Exosomes derived from HBV-infected LO2 cells promote LX-2 cell activation and liver fibrosis in mouse Exosomal miR-222 derived from HBV-infected LO2 cells promotes LX-2 cell activation TFRC is a target of miR-222 and inhibits LX-2 cell activation induced by miR-222 miR-222 promotes LX-2 cell activation through inhibiting TFRC-induced ferroptosis.
References
Ref 1 Exosomes derived from hepatitis B virus-infected hepatocytes promote liver fibrosis via miR-222/TFRC axis. Cell Biol Toxicol. 2023 Apr;39(2):467-481. doi: 10.1007/s10565-021-09684-z. Epub 2022 Jan 3.