General Information of the Ferroptosis Regulator (ID: REG50007)
Regulator Name hsa-mir-214 (Precursor RNA)
Synonyms
hsa-mir-214
    Click to Show/Hide
Gene Name hsa-mir-214
Regulator Type Precursor RNA
MiRBase ID MI0000290
Sequence
GGCCUGGCUGGACAGAGUUGUCAUGUGUCUGCCUGUCUACACUUGCUGUGCAGAACAUCC
GCUCACCUGUACAGCAGGCACAGACAGGCAGUCACAUGACAACCCAGCCU

    Click to Show/Hide
Full List of the Ferroptosis Target of This Regulator and Corresponding Disease/Drug Response(s)
hsa-mir-214 can regulate the following target(s), and cause disease/drug response(s). You can browse detail information of target(s) or disease/drug response(s).
Browse Target
Browse Disease
Transferrin receptor protein 1 (TFRC) [Driver; Suppressor; Marker]
In total 2 item(s) under this target
Experiment 1 Reporting the Ferroptosis Target of This Regulator [1]
Target for Ferroptosis Marker/Suppressor/Driver
Responsed Disease Cerebral ischaemic stroke ICD-11: 8B11
Pathway Response Fatty acid metabolism hsa01212
Ferroptosis hsa04216
Cell Process Cell ferroptosis
In Vitro Model
PC12 cells Adrenal gland pheochromocytoma Rattus norvegicus CVCL_0481
Response regulation PVT1 regulates ferroptosis through miR-214-mediated p53 and TFR1. The discovery of PVT1 and miR-214 as potential targets for I/R also implies that PVT1 and miR-214 play critical roles in ferroptosis, shedding new light on the mechanism of ferroptosis in acute ischemic stroke.
Experiment 2 Reporting the Ferroptosis Target of This Regulator [1]
Target for Ferroptosis Marker/Suppressor/Driver
Responsed Disease Cerebral ischaemic stroke ICD-11: 8B11
Pathway Response Fatty acid metabolism hsa01212
Ferroptosis hsa04216
Cell Process Cell ferroptosis
In Vitro Model
PC12 cells Adrenal gland pheochromocytoma Rattus norvegicus CVCL_0481
Response regulation PVT1 regulates ferroptosis through miR-214-mediated p53 and TFR1. The discovery of PVT1 and miR-214 as potential targets for I/R also implies that PVT1 and miR-214 play critical roles in ferroptosis, shedding new light on the mechanism of ferroptosis in acute ischemic stroke.
Unspecific Target [Unspecific Target]
In total 1 item(s) under this target
Experiment 1 Reporting the Ferroptosis Target of This Regulator [2]
Responsed Disease Hepatocellular carcinoma ICD-11: 2C12
Pathway Response Fatty acid metabolism hsa01212
Ferroptosis hsa04216
Cell Process Cell ferroptosis
In Vitro Model
Hep-G2 cells Hepatoblastoma Homo sapiens CVCL_0027
Hep 3B2.1-7 cells Hepatocellular carcinoma Homo sapiens CVCL_0326
In Vivo Model
The 5-week-old nude mice (BALB/c) were purchased from Beijing HFK Bioscience Co., Ltd. (China). Hep3B cells (7 x 106) stably transfected with NC1 or pre-miR-214 plasmid were subcutaneously injected into the nude mice. When the tumor sizes reached approximately >50 mm3, mice in Groups B and C were treated with 15 mg/kg erastin (MCE, China) twice every day for 20 days. Mice in Group A were treated with an equal volume vehicle.

    Click to Show/Hide
Response regulation The ferroptosis-promoting effects of miR-214 in hepatocellular carcinoma cells are attributed at least to its inhibitory effects on ATF4, which may provide a new target for therapy of hepatoma regarding ferroptosis.
Cerebral ischaemic stroke [ICD-11: 8B11]
In total 2 item(s) under this disease
Experiment 1 Reporting the Ferroptosis-centered Disease Response [1]
Target Regulator hsa-mir-214 (Precursor RNA) Precursor RNA
Pathway Response Fatty acid metabolism hsa01212
Ferroptosis hsa04216
Cell Process Cell ferroptosis
In Vitro Model
PC12 cells Adrenal gland pheochromocytoma Rattus norvegicus CVCL_0481
Response regulation PVT1 regulates ferroptosis through miR-214-mediated p53 and TFR1. The discovery of PVT1 and miR-214 as potential targets for I/R also implies that PVT1 and miR-214 play critical roles in ferroptosis, shedding new light on the mechanism of ferroptosis in acute ischemic stroke.
Experiment 2 Reporting the Ferroptosis-centered Disease Response [1]
Target Regulator hsa-mir-214 (Precursor RNA) Precursor RNA
Pathway Response Fatty acid metabolism hsa01212
Ferroptosis hsa04216
Cell Process Cell ferroptosis
In Vitro Model
PC12 cells Adrenal gland pheochromocytoma Rattus norvegicus CVCL_0481
Response regulation PVT1 regulates ferroptosis through miR-214-mediated p53 and TFR1. The discovery of PVT1 and miR-214 as potential targets for I/R also implies that PVT1 and miR-214 play critical roles in ferroptosis, shedding new light on the mechanism of ferroptosis in acute ischemic stroke.
Hepatocellular carcinoma [ICD-11: 2C12]
In total 1 item(s) under this disease
Experiment 1 Reporting the Ferroptosis-centered Disease Response [2]
Target Regulator hsa-mir-214 (Precursor RNA) Precursor RNA
Pathway Response Fatty acid metabolism hsa01212
Ferroptosis hsa04216
Cell Process Cell ferroptosis
In Vitro Model
Hep-G2 cells Hepatoblastoma Homo sapiens CVCL_0027
Hep 3B2.1-7 cells Hepatocellular carcinoma Homo sapiens CVCL_0326
In Vivo Model
The 5-week-old nude mice (BALB/c) were purchased from Beijing HFK Bioscience Co., Ltd. (China). Hep3B cells (7 x 106) stably transfected with NC1 or pre-miR-214 plasmid were subcutaneously injected into the nude mice. When the tumor sizes reached approximately >50 mm3, mice in Groups B and C were treated with 15 mg/kg erastin (MCE, China) twice every day for 20 days. Mice in Group A were treated with an equal volume vehicle.

    Click to Show/Hide
Response regulation The ferroptosis-promoting effects of miR-214 in hepatocellular carcinoma cells are attributed at least to its inhibitory effects on ATF4, which may provide a new target for therapy of hepatoma regarding ferroptosis.
References
Ref 1 LncRNA PVT1 regulates ferroptosis through miR-214-mediated TFR1 and p53. Life Sci. 2020 Nov 1;260:118305. doi: 10.1016/j.lfs.2020.118305. Epub 2020 Aug 20.
Ref 2 MicroRNA-214-3p enhances erastin-induced ferroptosis by targeting ATF4 in hepatoma cells. J Cell Physiol. 2020 Jul;235(7-8):5637-5648. doi: 10.1002/jcp.29496. Epub 2020 Jan 21.