Ferroptosis Regulator Information

General Information of the Ferroptosis Regulator (ID: REG50006)
Regulator Name hsa-mir-27a (Precursor RNA)
Synonyms
hsa-mir-27a
    Click to Show/Hide
Gene Name hsa-mir-27a
Regulator Type Precursor RNA
MiRBase ID MI0000085
Sequence
CUGAGGAGCAGGGCUUAGCUGCUUGUGAGCAGGGUCCACACCAAGUCGUGUUCACAGUGG
CUAAGUUCCGCCCCCCAG

    Click to Show/Hide
Full List of the Ferroptosis Target of This Regulator and Corresponding Disease/Drug Response(s)
hsa-mir-27a can regulate the following target(s), and cause disease/drug response(s). You can browse detail information of target(s) or disease/drug response(s).
Browse Target
Browse Disease
Cystine/glutamate transporter (SLC7A11) [Driver; Suppressor]
 Target Info 
In total 1 item(s) under this target
Experiment 1 Reporting the Ferroptosis Target of This Regulator [1]
Target for Ferroptosis Suppressor
Responsed Disease Cerebral ischemia ICD-11: 8B10
 Disease Info 
Pathway Response Fatty acid metabolism hsa01212
Cell Process Cell ferroptosis
In Vitro Model
 hBCs (Brain cells)
In Vivo Model
The male Sprague Dawley rats were randomly divided into control group, sham group, middle cerebral artery occlusion/reperfusion model group (MCAO/R group) (according to different ischemia reperfusion time, the model group was divided into the 3, 6, 12 and 24 hours reperfusion groups after 2 hour-ischemia), and vehicle group, agomir-27a group, antagomir-27a group. The Zea-Longa method was used to establish rat MCAO model.

    Click to Show/Hide
Response regulation In the process of cerebral ischemia and reperfusion, the up-regulated miR-27a may induce ferroptosis through inhibiting SLC7A11, thus causing brain tissue damage.
Cerebral ischemia [ICD-11: 8B10]
 Disease Info 
In total 1 item(s) under this disease
Experiment 1 Reporting the Ferroptosis-centered Disease Response [1]
Target Regulator hsa-mir-27a (Precursor RNA) Precursor RNA
 Regulator Info 
Pathway Response Fatty acid metabolism hsa01212
Cell Process Cell ferroptosis
In Vitro Model
 hBCs (Brain cells)
In Vivo Model
The male Sprague Dawley rats were randomly divided into control group, sham group, middle cerebral artery occlusion/reperfusion model group (MCAO/R group) (according to different ischemia reperfusion time, the model group was divided into the 3, 6, 12 and 24 hours reperfusion groups after 2 hour-ischemia), and vehicle group, agomir-27a group, antagomir-27a group. The Zea-Longa method was used to establish rat MCAO model.

    Click to Show/Hide
Response regulation In the process of cerebral ischemia and reperfusion, the up-regulated miR-27a may induce ferroptosis through inhibiting SLC7A11, thus causing brain tissue damage.
References
Ref 1 [miR-27a induces ferroptosis by inhibiting solute carrier family 7 member-11 (SLC7A11) and causes cerebral ischemia-reperfusion injury in rats]. Xi Bao Yu Fen Zi Mian Yi Xue Za Zhi. 2022 Jul;38(7):617-624.