Ferroptosis Regulator Information

General Information of the Ferroptosis Regulator (ID: REG50001)
Regulator Name hsa-mir-15a (Precursor RNA)
Synonyms
hsa-mir-15a
    Click to Show/Hide
Gene Name hsa-mir-15a
Regulator Type Precursor RNA
MiRBase ID MI0000069
Sequence
CCUUGGAGUAAAGUAGCAGCACAUAAUGGUUUGUGGAUUUUGAAAAGGUGCAGGCCAUAU
UGUGCUGCCUCAAAAAUACAAGG

    Click to Show/Hide
Full List of the Ferroptosis Target of This Regulator and Corresponding Disease/Drug Response(s)
hsa-mir-15a can regulate the following target(s), and cause disease/drug response(s). You can browse detail information of target(s) or disease/drug response(s).
Browse Target
Browse Disease
Phospholipid hydroperoxide glutathione peroxidase (GPX4) [Suppressor]
 Target Info 
In total 1 item(s) under this target
Experiment 1 Reporting the Ferroptosis Target of This Regulator [1]
Target for Ferroptosis Suppressor
Responsed Disease Prostate cancer ICD-11: 2C82
 Disease Info 
Pathway Response Fatty acid metabolism hsa01212
Ferroptosis hsa04216
Cell Process Cell ferroptosis
Cell proliferation
In Vitro Model
 LNCaP cells Prostate carcinoma Homo sapiens CVCL_0395
Response regulation MiR-15a induces ferroptosis by regulating GPX4 in prostate cancer cells, which provides evidence for investigating the therapeutic strategies of prostate cancer.
Prostate cancer [ICD-11: 2C82]
 Disease Info 
In total 1 item(s) under this disease
Experiment 1 Reporting the Ferroptosis-centered Disease Response [1]
Target Regulator hsa-mir-15a (Precursor RNA) Precursor RNA
 Regulator Info 
Pathway Response Fatty acid metabolism hsa01212
Ferroptosis hsa04216
Cell Process Cell ferroptosis
Cell proliferation
In Vitro Model
 LNCaP cells Prostate carcinoma Homo sapiens CVCL_0395
Response regulation MiR-15a induces ferroptosis by regulating GPX4 in prostate cancer cells, which provides evidence for investigating the therapeutic strategies of prostate cancer.
References
Ref 1 MicroRNA-15a promotes prostate cancer cell ferroptosis by inhibiting GPX4 expression. Oncol Lett. 2022 Feb;23(2):67. doi: 10.3892/ol.2022.13186. Epub 2022 Jan 3.