General Information of the Ferroptosis Regulator (ID: REG20152)
Regulator Name hsa-miR-6516-5p (miRNA)
Synonyms
hsa-miR-6516-5p
    Click to Show/Hide
Gene Name hsa-miR-6516-5p
Regulator Type miRNA
MiRBase ID MIMAT0030417
Sequence
UUUGCAGUAACAGGUGUGAGCA

    Click to Show/Hide
Full List of the Ferroptosis Target of This Regulator and Corresponding Disease/Drug Response(s)
hsa-miR-6516-5p can regulate the following target(s), and cause disease/drug response(s). You can browse detail information of target(s) or disease/drug response(s).
Browse Target
Browse Disease
Phospholipid hydroperoxide glutathione peroxidase (GPX4) [Suppressor]
In total 1 item(s) under this target
Experiment 1 Reporting the Ferroptosis Target of This Regulator [1]
Target for Ferroptosis Suppressor
Responsed Disease Endometriosis ICD-11: GA10
Pathway Response Glutathione metabolism hsa00480
Fatty acid metabolism hsa01212
Cell Process Cell ferroptosis
Cell proliferation
Cell migration
In Vitro Model
hEECs (Human esophageal epithelial cells)
mESCs (Mouse endometrial stromal cells)
mEESCs (Mouse ectopic endometrial stromal cells)
In Vivo Model
Female BALB/c mice (4-6 weeks old, 18-20 g) were obtained from Shanghai Regan Biotechnology Co., Ltd. (Shanghai, China) and were reared in a specific, pathogen-free facility. After 1 week of acclimatization, mice were randomly divided into two groups: the donor group (n = 10) and recipient groups (n = 10). Ovariosteresis and estradiol valerate injection (0.5 ug/mouse/week; Aladdin, Shanghai, China) was carried out to avoid differences in the estrous cycle. Mice were anesthetized by 2% isoflurane, and then the ovaries on both sides were exposed through flank incisions and removed. Donor mice were sacrificed under isoflurane anesthesia, and each uterine horn of the donor mice was concentrated and peeled in warm PBS to remove uterine muscle. Endometrial tissues were weighed and cut into small fragments with scissors and resuspended in sterile PBS with 1 x ampicillin (Beyotime, Shanghai, China). After that, endometrium preparation was intraperitoneally injected into two recipient mice (50 mg/mouse). Two weeks after EM transplantation, endometriosis lesions and eutopic endometrial tissues were removed from the peritoneal cavities and uteri.

    Click to Show/Hide
Response regulation ADAMTS9-AS1 functioned as a competing endogenous RNA (ceRNA) by sponging miR-6516-5p to derepress the expression of GPX4, the critical repressor of ferroptosis. Taken together, these results demonstrate that upregulated ADAMTS9-AS1 accelerates ESC proliferation and migration by regulating miR-6516-5p/GPX4-dependent ferroptosis and may be a potential target for the treatment of Endometriosis.
Endometriosis [ICD-11: GA10]
In total 1 item(s) under this disease
Experiment 1 Reporting the Ferroptosis-centered Disease Response [1]
Target Regulator hsa-miR-6516-5p (miRNA) miRNA
Pathway Response Glutathione metabolism hsa00480
Fatty acid metabolism hsa01212
Cell Process Cell ferroptosis
Cell proliferation
Cell migration
In Vitro Model
hEECs (Human esophageal epithelial cells)
mESCs (Mouse endometrial stromal cells)
mEESCs (Mouse ectopic endometrial stromal cells)
In Vivo Model
Female BALB/c mice (4-6 weeks old, 18-20 g) were obtained from Shanghai Regan Biotechnology Co., Ltd. (Shanghai, China) and were reared in a specific, pathogen-free facility. After 1 week of acclimatization, mice were randomly divided into two groups: the donor group (n = 10) and recipient groups (n = 10). Ovariosteresis and estradiol valerate injection (0.5 ug/mouse/week; Aladdin, Shanghai, China) was carried out to avoid differences in the estrous cycle. Mice were anesthetized by 2% isoflurane, and then the ovaries on both sides were exposed through flank incisions and removed. Donor mice were sacrificed under isoflurane anesthesia, and each uterine horn of the donor mice was concentrated and peeled in warm PBS to remove uterine muscle. Endometrial tissues were weighed and cut into small fragments with scissors and resuspended in sterile PBS with 1 x ampicillin (Beyotime, Shanghai, China). After that, endometrium preparation was intraperitoneally injected into two recipient mice (50 mg/mouse). Two weeks after EM transplantation, endometriosis lesions and eutopic endometrial tissues were removed from the peritoneal cavities and uteri.

    Click to Show/Hide
Response regulation ADAMTS9-AS1 functioned as a competing endogenous RNA (ceRNA) by sponging miR-6516-5p to derepress the expression of GPX4, the critical repressor of ferroptosis. Taken together, these results demonstrate that upregulated ADAMTS9-AS1 accelerates ESC proliferation and migration by regulating miR-6516-5p/GPX4-dependent ferroptosis and may be a potential target for the treatment of Endometriosis.
References
Ref 1 Long noncoding RNA ADAMTS9-AS1 represses ferroptosis of endometrial stromal cells by regulating the miR-6516-5p/GPX4 axis in endometriosis. Sci Rep. 2022 Feb 16;12(1):2618. doi: 10.1038/s41598-022-04963-z.