Ferroptosis Regulator Information

General Information of the Ferroptosis Regulator (ID: REG20151)
Regulator Name hsa-miR-6862-5p (miRNA)
Synonyms
hsa-miR-6862-5p
    Click to Show/Hide
Gene Name hsa-miR-6862-5p
Regulator Type miRNA
MiRBase ID MIMAT0027625
Sequence
CGGGCAUGCUGGGAGAGACUUU

    Click to Show/Hide
Full List of the Ferroptosis Target of This Regulator and Corresponding Disease/Drug Response(s)
hsa-miR-6862-5p can regulate the following target(s), and cause disease/drug response(s). You can browse detail information of target(s) or disease/drug response(s).
Browse Target
Browse Disease
Nuclear receptor coactivator 4 (NCOA4) [Driver]
 Target Info 
In total 1 item(s) under this target
Experiment 1 Reporting the Ferroptosis Target of This Regulator [1]
Target for Ferroptosis Driver
Responsed Disease Fibrosarcoma ICD-11: 2B53
 Disease Info 
Pathway Response Fatty acid metabolism hsa01212
Ferroptosis hsa04216
Autophagy hsa04140
Cell Process Cell ferroptosis
Cell autophagy
In Vitro Model
 HT-1080 cells Fibrosarcoma Homo sapiens CVCL_0317
Response regulation Reduced NCOA4 expression resulted from a lower rate of hypoxic NCOA4 transcription combined with a micro RNA 6862-5p-dependent degradation of NCOA4 mRNA, the latter being regulated by c-jun N-terminal kinase (JNK). Pharmacological inhibition of JNK under hypoxia increased NCOA4 and prevented FTMT induction in Fibrosarcoma.
Fibrosarcoma [ICD-11: 2B53]
 Disease Info 
In total 1 item(s) under this disease
Experiment 1 Reporting the Ferroptosis-centered Disease Response [1]
Target Regulator hsa-miR-6862-5p (miRNA) miRNA
 Regulator Info 
Pathway Response Fatty acid metabolism hsa01212
Ferroptosis hsa04216
Autophagy hsa04140
Cell Process Cell ferroptosis
Cell autophagy
In Vitro Model
 HT-1080 cells Fibrosarcoma Homo sapiens CVCL_0317
Response regulation Reduced NCOA4 expression resulted from a lower rate of hypoxic NCOA4 transcription combined with a micro RNA 6862-5p-dependent degradation of NCOA4 mRNA, the latter being regulated by c-jun N-terminal kinase (JNK). Pharmacological inhibition of JNK under hypoxia increased NCOA4 and prevented FTMT induction in Fibrosarcoma.
References
Ref 1 Hypoxia inhibits ferritinophagy, increases mitochondrial ferritin, and protects from ferroptosis. Redox Biol. 2020 Sep;36:101670. doi: 10.1016/j.redox.2020.101670. Epub 2020 Aug 3.