General Information of the Ferroptosis Regulator (ID: REG20150)
Regulator Name hsa-miR-3938 (miRNA)
Synonyms
hsa-miR-3938
    Click to Show/Hide
Gene Name hsa-miR-3938
Regulator Type miRNA
MiRBase ID MIMAT0018353
Sequence
AAUUCCCUUGUAGAUAACCCGG

    Click to Show/Hide
Full List of the Ferroptosis Target of This Regulator and Corresponding Disease/Drug Response(s)
hsa-miR-3938 can regulate the following target(s), and cause disease/drug response(s). You can browse detail information of target(s) or disease/drug response(s).
Browse Target
Browse Disease
Cystine/glutamate transporter (SLC7A11) [Driver; Suppressor]
In total 1 item(s) under this target
Experiment 1 Reporting the Ferroptosis Target of This Regulator [1]
Target for Ferroptosis Suppressor
Responsed Disease Glioblastoma ICD-11: 2A00
Pathway Response Ferroptosis hsa04216
Fatty acid metabolism hsa01212
Cell Process Cell ferroptosis
Cell proliferation
Cell migration
Cell invasion
In Vitro Model
HEB (Human glial cells)
SF126 cells Glioblastoma Homo sapiens CVCL_1688
U87 MG-Red-Fluc cells Glioblastoma Homo sapiens CVCL_5J12
U-251MG cells Astrocytoma Homo sapiens CVCL_0021
In Vivo Model
4-week-old female BALB/c nude mice were acquired from the National Laboratory Animal Center (Shanghai, China). Overall, 10 mice (n = 5 each group) were implanted with U251 cells stably knockdown circCDK14 by lentiviruses carrying sh-circCDK14 (Wanleibio, China), or control U251 cells with lentiviruses carrying sh-NC (Wanleibio, China). 5 x 106 cells were resuspended in phosphatebuffered saline (100 ul) and Matrigel substrate (100 ul) and injected into the right flank of nude mice. Tumor volume was documented once 7 days after implantation.

    Click to Show/Hide
Response regulation CircCDK14 promotes the migration, invasion and proliferation of glioma cells in vitroas well as tumorigenesisin vivo. An evaluation of the underlying mechanism revealed that circCDK14 sponged miR-3938 to upregulate oncogenic gene PDGFRA expression. After knockdown of circCDK14 in glioma cells, protein levels of SLC7A11 and GPX4 decreased significantly and Fp became more sensitivity.
Glioblastoma [ICD-11: 2A00]
In total 1 item(s) under this disease
Experiment 1 Reporting the Ferroptosis-centered Disease Response [1]
Target Regulator hsa-miR-3938 (miRNA) miRNA
Pathway Response Ferroptosis hsa04216
Fatty acid metabolism hsa01212
Cell Process Cell ferroptosis
Cell proliferation
Cell migration
Cell invasion
In Vitro Model
HEB (Human glial cells)
SF126 cells Glioblastoma Homo sapiens CVCL_1688
U87 MG-Red-Fluc cells Glioblastoma Homo sapiens CVCL_5J12
U-251MG cells Astrocytoma Homo sapiens CVCL_0021
In Vivo Model
4-week-old female BALB/c nude mice were acquired from the National Laboratory Animal Center (Shanghai, China). Overall, 10 mice (n = 5 each group) were implanted with U251 cells stably knockdown circCDK14 by lentiviruses carrying sh-circCDK14 (Wanleibio, China), or control U251 cells with lentiviruses carrying sh-NC (Wanleibio, China). 5 x 106 cells were resuspended in phosphatebuffered saline (100 ul) and Matrigel substrate (100 ul) and injected into the right flank of nude mice. Tumor volume was documented once 7 days after implantation.

    Click to Show/Hide
Response regulation CircCDK14 promotes the migration, invasion and proliferation of glioma cells in vitroas well as tumorigenesisin vivo. An evaluation of the underlying mechanism revealed that circCDK14 sponged miR-3938 to upregulate oncogenic gene PDGFRA expression. After knockdown of circCDK14 in glioma cells, protein levels of SLC7A11 and GPX4 decreased significantly and Fp became more sensitivity.
References
Ref 1 CircCDK14 Promotes Tumor Progression and Resists Ferroptosis in Glioma by Regulating PDGFRA. Int J Biol Sci. 2022 Jan 1;18(2):841-857. doi: 10.7150/ijbs.66114. eCollection 2022.