Ferroptosis Regulator Information

General Information of the Ferroptosis Regulator (ID: REG20149)
Regulator Name hsa-miR-3200-5p (miRNA)
Synonyms
hsa-miR-3200-5p
    Click to Show/Hide
Gene Name hsa-miR-3200-5p
Regulator Type miRNA
MiRBase ID MIMAT0017392
Sequence
AAUCUGAGAAGGCGCACAAGGU

    Click to Show/Hide
Full List of the Ferroptosis Target of This Regulator and Corresponding Disease/Drug Response(s)
hsa-miR-3200-5p can regulate the following target(s), and cause disease/drug response(s). You can browse detail information of target(s) or disease/drug response(s).
Browse Target
Browse Disease
Phospholipid hydroperoxide glutathione peroxidase (GPX4) [Suppressor]
 Target Info 
In total 1 item(s) under this target
Experiment 1 Reporting the Ferroptosis Target of This Regulator [1]
Target for Ferroptosis Suppressor
Responsed Disease Hepatocellular carcinoma ICD-11: 2C12
 Disease Info 
Pathway Response Fatty acid metabolism hsa01212
Cell Process Cell ferroptosis
In Vitro Model
 SMMC-7721 cells Endocervical adenocarcinoma Homo sapiens CVCL_0534
BEL-7402 cells Endocervical adenocarcinoma Homo sapiens CVCL_5492
Response regulation The expression of ferroptosis-related protein GPX4 decreased after HULC knockdown, and the GPX4 expression level was reversed when the inhibitor miR-3200-5p was added simultaneously. HULC was found to function as a ceRNA of miR-3200-5p, and miR-3200-5p regulates ferroptosis by targeting ATF4, resulting in the inhibition of proliferation and metastasis within hepatocellular carcinoma cells.
Hepatocellular carcinoma [ICD-11: 2C12]
 Disease Info 
In total 1 item(s) under this disease
Experiment 1 Reporting the Ferroptosis-centered Disease Response [1]
Target Regulator hsa-miR-3200-5p (miRNA) miRNA
 Regulator Info 
Pathway Response Fatty acid metabolism hsa01212
Cell Process Cell ferroptosis
In Vitro Model
 SMMC-7721 cells Endocervical adenocarcinoma Homo sapiens CVCL_0534
BEL-7402 cells Endocervical adenocarcinoma Homo sapiens CVCL_5492
Response regulation The expression of ferroptosis-related protein GPX4 decreased after HULC knockdown, and the GPX4 expression level was reversed when the inhibitor miR-3200-5p was added simultaneously. HULC was found to function as a ceRNA of miR-3200-5p, and miR-3200-5p regulates ferroptosis by targeting ATF4, resulting in the inhibition of proliferation and metastasis within hepatocellular carcinoma cells.
References
Ref 1 Downregulation of HULC Induces Ferroptosis in Hepatocellular Carcinoma via Targeting of the miR-3200-5p/ATF4 Axis. Oxid Med Cell Longev. 2022 May 16;2022:9613095. doi: 10.1155/2022/9613095. eCollection 2022.