Ferroptosis Regulator Information

General Information of the Ferroptosis Regulator (ID: REG20143)
Regulator Name hsa-miR-1231 (miRNA)
Synonyms
hsa-miR-1231
    Click to Show/Hide
Gene Name hsa-miR-1231
Regulator Type miRNA
MiRBase ID MIMAT0005586
Sequence
GUGUCUGGGCGGACAGCUGC

    Click to Show/Hide
Full List of the Ferroptosis Target of This Regulator and Corresponding Disease/Drug Response(s)
hsa-miR-1231 can regulate the following target(s), and cause disease/drug response(s). You can browse detail information of target(s) or disease/drug response(s).
Browse Target
Browse Disease
Phospholipid hydroperoxide glutathione peroxidase (GPX4) [Suppressor]
 Target Info 
In total 1 item(s) under this target
Experiment 1 Reporting the Ferroptosis Target of This Regulator [1]
Target for Ferroptosis Suppressor
Responsed Disease Thyroid cancer ICD-11: 2D10
 Disease Info 
Pathway Response Glutathione metabolism hsa00480
Cell Process Cell ferroptosis
Cell proliferation
In Vitro Model
 KAT-5 cells Colon adenocarcinoma Homo sapiens CVCL_0370
TPC-1 cells Thyroid gland papillary carcinoma Homo sapiens CVCL_6298
In Vivo Model
KAT-5 and TPC-1 cells (2 x 107) were subcutaneously injected into nude mice (four mice/group, 4-week-old) and treated with intratumoral injection (50 uL si-circCON, si-circKIF4A) every four days. The volume of tumors was estimated every four days according to the formula 0.5 x width2 x length. After 28 days, the tumors were weighed. Forin vivolung metastasis assay, cells (1 x 105) were injected through tail veins (four mice/group).

    Click to Show/Hide
Response regulation circKIF4A facilitated the malignant progress of papillary thyroid tumor by sponging miR-1231 and upregulating GPX4 expression. And circKIF4A- miR-1231-GPX4 axis played a vital role in cancer proliferation and ferroptosis by competing endogenous RNAs. Therefore, targeting circKIF4A is very likely to be a potential method for treatment of papillary thyroid cancer in the future.
Thyroid cancer [ICD-11: 2D10]
 Disease Info 
In total 1 item(s) under this disease
Experiment 1 Reporting the Ferroptosis-centered Disease Response [1]
Target Regulator hsa-miR-1231 (miRNA) miRNA
 Regulator Info 
Pathway Response Glutathione metabolism hsa00480
Cell Process Cell ferroptosis
Cell proliferation
In Vitro Model
 KAT-5 cells Colon adenocarcinoma Homo sapiens CVCL_0370
TPC-1 cells Thyroid gland papillary carcinoma Homo sapiens CVCL_6298
In Vivo Model
KAT-5 and TPC-1 cells (2 x 107) were subcutaneously injected into nude mice (four mice/group, 4-week-old) and treated with intratumoral injection (50 uL si-circCON, si-circKIF4A) every four days. The volume of tumors was estimated every four days according to the formula 0.5 x width2 x length. After 28 days, the tumors were weighed. Forin vivolung metastasis assay, cells (1 x 105) were injected through tail veins (four mice/group).

    Click to Show/Hide
Response regulation circKIF4A facilitated the malignant progress of papillary thyroid tumor by sponging miR-1231 and upregulating GPX4 expression. And circKIF4A- miR-1231-GPX4 axis played a vital role in cancer proliferation and ferroptosis by competing endogenous RNAs. Therefore, targeting circKIF4A is very likely to be a potential method for treatment of papillary thyroid cancer in the future.
References
Ref 1 Circular RNA circKIF4A facilitates the malignant progression and suppresses ferroptosis by sponging miR-1231 and upregulating GPX4 in papillary thyroid cancer. Aging (Albany NY). 2021 Jun 21;13(12):16500-16512. doi: 10.18632/aging.203172. Epub 2021 Jun 21.