General Information of the Ferroptosis Regulator (ID: REG20142)
Regulator Name hsa-miR-541-3p (miRNA)
Synonyms
hsa-miR-541-3p
    Click to Show/Hide
Gene Name hsa-miR-541-3p
Regulator Type miRNA
MiRBase ID MIMAT0004920
Sequence
UGGUGGGCACAGAAUCUGGACU

    Click to Show/Hide
Full List of the Ferroptosis Target of This Regulator and Corresponding Disease/Drug Response(s)
hsa-miR-541-3p can regulate the following target(s), and cause disease/drug response(s). You can browse detail information of target(s) or disease/drug response(s).
Browse Target
Browse Disease
Phospholipid hydroperoxide glutathione peroxidase (GPX4) [Suppressor]
In total 1 item(s) under this target
Experiment 1 Reporting the Ferroptosis Target of This Regulator [1]
Target for Ferroptosis Suppressor
Responsed Disease Hepatocellular carcinoma ICD-11: 2C12
Pathway Response Fatty acid metabolism hsa01212
Ferroptosis hsa04216
Cell Process Cell ferroptosis
Cell proliferation
In Vitro Model
THLE-2 cells Normal Homo sapiens CVCL_3803
Huh-7 cells Hepatocellular carcinoma Homo sapiens CVCL_0336
HCCLM3 cells Adult hepatocellular carcinoma Homo sapiens CVCL_6832
In Vivo Model
The 5-week-old BALB/c male nude mice (n = 10) were purchased from the Animal Center of the Chinese Academy of Medical Sciences (Beijing, China). A number of 2 x 106 HuH-7 cells were transfected with lentiviral vectors containing sh-circIL4R or sh-NC to establish the stably expressed cell lines. Ten mice were subcutaneously injected with HuH-7 cells with sh-circIL4R or sh-NC (five mice per group), constructing the xenograft model of HCC in vivo. Every 5 days after injection, tumor size was measured by a vernier caliper and tumor volume (length x width2 x 0.5) was calculated.

    Click to Show/Hide
Response regulation CircIL4R acted as a miR-541-3p sponge to regulate its target glutathione peroxidase 4 (GPX4). GPX4 upregulation relieved the miR-541-3p-induced tumor inhibition and ferroptosis aggravation. CircIL4R played an oncogenic role in hepatocellular carcinoma via the miR-541-3p/GPX4 axis in vivo.
Hepatocellular carcinoma [ICD-11: 2C12]
In total 1 item(s) under this disease
Experiment 1 Reporting the Ferroptosis-centered Disease Response [1]
Target Regulator hsa-miR-541-3p (miRNA) miRNA
Pathway Response Fatty acid metabolism hsa01212
Ferroptosis hsa04216
Cell Process Cell ferroptosis
Cell proliferation
In Vitro Model
THLE-2 cells Normal Homo sapiens CVCL_3803
Huh-7 cells Hepatocellular carcinoma Homo sapiens CVCL_0336
HCCLM3 cells Adult hepatocellular carcinoma Homo sapiens CVCL_6832
In Vivo Model
The 5-week-old BALB/c male nude mice (n = 10) were purchased from the Animal Center of the Chinese Academy of Medical Sciences (Beijing, China). A number of 2 x 106 HuH-7 cells were transfected with lentiviral vectors containing sh-circIL4R or sh-NC to establish the stably expressed cell lines. Ten mice were subcutaneously injected with HuH-7 cells with sh-circIL4R or sh-NC (five mice per group), constructing the xenograft model of HCC in vivo. Every 5 days after injection, tumor size was measured by a vernier caliper and tumor volume (length x width2 x 0.5) was calculated.

    Click to Show/Hide
Response regulation CircIL4R acted as a miR-541-3p sponge to regulate its target glutathione peroxidase 4 (GPX4). GPX4 upregulation relieved the miR-541-3p-induced tumor inhibition and ferroptosis aggravation. CircIL4R played an oncogenic role in hepatocellular carcinoma via the miR-541-3p/GPX4 axis in vivo.
References
Ref 1 CircIL4R facilitates the tumorigenesis and inhibits ferroptosis in hepatocellular carcinoma by regulating the miR-541-3p/GPX4 axis. Cell Biol Int. 2020 Nov;44(11):2344-2356. doi: 10.1002/cbin.11444. Epub 2020 Aug 31.